PageRenderTime 37ms CodeModel.GetById 16ms app.highlight 7ms RepoModel.GetById 1ms app.codeStats 1ms

/test-data/extract_genomic_dna_out1.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 456 lines | 456 code | 0 blank | 0 comment | 0 complexity | c3fd44d8b67a92d770bee00fca303601 MD5 | raw file
  1>hg17_chr1_147962192_147962580_-
  2ACTTGATCCTGCTCCCTCGGTGTCTGCATTGACTCCTCATGCTGGGACTG
  3GACCCGTCAACCCCCCTGCTCGCTGCTCACGTACCTTCATCACTTTTAGT
  4GATGATGCAACTTTCGAGGAATGGTTCCCCCAAGGGCGGCCCCCAAAAGT
  5CCCTGTTCGTGAGGTCTGTCCAGTGACCCATCGTCCAGCCCTATACCGGG
  6ACCCTGTTACAGACATACCCTATGCCACTGCTCGAGCCTTCAAGATCATT
  7CGTGAGGCTTACAAGAAGTACATTACTGCCCATGGACTGCCGCCCACTGC
  8CTCAGCCCTGGGCCCCGGCCCGCCACCTCCTGAGCCCCTCCCTGGCTCTG
  9GGCCCCGAGCCTTGCGCCAGAAAATTGTCATTAAATGA
 10>hg17_chr1_147984545_147984630_+
 11ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTT
 12TGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG
 13>hg17_chr1_148078400_148078582_-
 14GTTCTCAGCTTCCTTGCTTCCATGGCTCCAGCACCATTCGAAACCTCAAA
 15GAGAGGTTCCACATGAGCATGACTGAGGAGCAGCTGCAGCTGCTGGTGGA
 16GCAGATGGTGGATGGCAGTATGCGGTCTATCACCACCAAACTCTATGACG
 17GCTTCCAGTACCTCACCAACGGCATCATGTGA
 18>hg17_chr1_148185136_148185276_+
 19ATGGAAGCGTTTTTGGGGTCGCGGTCCGGACTTTGGGCGGGGGGTCCGGC
 20CCCAGGACAGTTTTACCGCATTCCGTCCACTCCCGATTCCTTCATGGATC
 21CGGCGTCTGCACTTTACAGAGGTCCAATCACGCGGACCCA
 22>hg17_chr10_55251623_55253124_-
 23TCTTTTCCTTCTCTACCATTTTCAACAAAGCAGGGGAAATAACTCAGTCT
 24CAGAAGACAGGAAACATCAACAAGTTGTGATGCCCTTTTCTTCCAATACT
 25ATTGAGGCTCACAAGTCAGCTCATGTAGACGGATCACTTAAGAGCAACAA
 26ACTGAAGTCTGCAAGAAAATTCACATTTCTATCTGATGAGGATGACTTAA
 27GTGCCCATAATCCCCTTTATAAGGAAAACATAAGTCAAGTATCAACAAAT
 28TCAGACATTTCACAGAGAACAGATTTTGTAGACCCATTTTCACCCAAAAT
 29ACAAGCCAAGAGTAAGTCTCTGAGGGGCCCAAGAGAAAAGATTCAGAGGC
 30TGTGGAGTCAGTCAGTCAGCTTACCCAGGAGGCTGATGAGGAAAGTTCCA
 31AATAGACCAGAGATCATAGATCTGCAGCAGTGGCAAGGCACCAGGCAGAA
 32AGCTGAAAATGAAAACACTGGAATCTGTACAAACAAAAGAGGTAGCAGCA
 33ATCCATTGCTTACAACTGAAGAGGCAAATTTGACAGAGAAAGAGGAAATA
 34AGGCAAGGTGAAACACTGATGATAGAAGGAACAGAACAGTTGAAATCTCT
 35CTCTTCAGACTCTTCATTTTGCTTTCCCAGGCCTCACTTCTCATTCTCCA
 36CTTTGCCAACTGTTTCAAGAACTGTGGAACTCAAATCAGAACCTAATGTC
 37ATCAGTTCTCCTGCTGAGTGTTCCTTGGAACTTTCTCCTTCAAGGCCTTG
 38TGTTTTACATTCTTCACTCTCTAGGAGAGAGACACCTATTTGTATGTTAC
 39CTATTGAAACCGAAAGAAATATTTTTGAAAATTTTGCCCATCCACCAAAC
 40ATCTCTCCTTCTGCCTGtccccttccccctcctcctcctatttctcctcc
 41ttctcctcctcctgctcctgctcctcttgctcctcctcctgacatttctc
 42ctttttctcttttttgtcctcctccctctcctccttctatccctcttcct
 43cttcctcctcctACATTTTTTCCACTTTCCGTTTCAACGTCTGGTCCCCC
 44AACAccacctcttctacctccatttccaactcctcttcctccaccacctc
 45cttctattccttgccctccacctccttcAGCTTCATTTCTGTCCACAGAG
 46TGTGTCTGTATAACAGGTGTTAAATGCACGACCAACTTGATGCCTGCCGA
 47GAAAATTAAGTCCTCTATGACACAGCTATCAACAACGACAGTGTGTAAAA
 48CAGACCCTCAGAGAGAACCAAAAGGCATCCTCAGACACGTTAAAAACTTA
 49GCAGAACTTGAAAAATCAGTAGCTAACATGTACAGTCAAATAGAAAAAAA
 50CTATCTACGCACAAATGTTTCAGAACTTCAAACTATGTGCCCTTCAGAAG
 51TAACAAATATGGAAATCACATCTGAACAAAACAAGGGGAGTTTGAACAAT
 52ATTGTCGAGGGAACTGAAAAACAATCTCACAGTCAATCTACTTCACTGTA
 53A
 54>hg17_chr11_116124407_116124501_-
 55ATCCAATGGATTTGAACAGAAGCGCTTTGCCAGGCTTGCCAGCAAGAAGG
 56CAGTGGAGGAACTTGCCTACAAATGGAGTGTTGAGGATATGTAA
 57>hg17_chr11_116206508_116206563_+
 58ATGCAGCCCCGGGTACTCCTTGTTGTTGCCCTCCTGGCGCTCCTGGCCTC
 59TGCCC
 60>hg17_chr11_116211733_116212337_-
 61CCTAAAGCTCCTTGACAACTGGGACAGCGTGACCTCCACCTTCAGCAAGC
 62TGCGCGAACAGCTCGGCCCTGTGACCCAGGAGTTCTGGGATAACCTGGAA
 63AAGGAGACAGAGGGCCTGAGGCAGGAGATGAGCAAGGATCTGGAGGAGGT
 64GAAGGCCAAGGTGCAGCCCTACCTGGACGACTTCCAGAAGAAGTGGCAGG
 65AGGAGATGGAGCTCTACCGCCAGAAGGTGGAGCCGCTGCGCGCAGAGCTC
 66CAAGAGGGCGCGCGCCAGAAGCTGCACGAGCTGCAAGAGAAGCTGAGCCC
 67ACTGGGCGAGGAGATGCGCGACCGCGCGCGCGCCCATGTGGACGCGCTGC
 68GCACGCATCTGGCCCCCTACAGCGACGAGCTGCGCCAGCGCTTGGCCGCG
 69CGCCTTGAGGCTCTCAAGGAGAACGGCGGCGCCAGACTGGCCGAGTACCA
 70CGCCAAGGCCACCGAGCATCTGAGCACGCTCAGCGAGAAGGCCAAGCCCG
 71CGCTCGAGGACCTCCGCCAAGGCCTGCTGCCCGTGCTGGAGAGCTTCAAG
 72GTCAGCTTCCTGAGCGCTCTCGAGGAGTACACTAAGAAGCTCAACACCCA
 73GTGA
 74>hg17_chr11_1812377_1812407_+
 75ATGCTCCACCTGCATGGCTGGCAAACCATG
 76>hg17_chr12_38440094_38440321_-
 77GAGCTTTCTTCCTCTATGCTGGATTTGCTGCTGTGGGACTCCTTTTCATC
 78TATGGCTGTCTTCCTGAGACCAAAGGCAAAAAATTAGAGGAAATTGAATC
 79ACTCTTTGACAACAGGCTATGTACATGTGGCACTTCAGATTCTGATGAAG
 80GGAGATATATTGAATATATTCGGGTAAAGGGAAGTAACTATCATCTTTCT
 81GACAATGATGCTTCTGATGTGGAATAA
 82>hg17_chr13_112381694_112381953_+
 83ATGAACTCACCAGAGGCGAGGCTCTGCGTTGCTCAATGCAGAGACTCTTA
 84CCCAGGGTGTCAGCCTCTGAAAGATACACGTGCCTGGGCCTCTTCCCTGA
 85AGATGGACCCGGCAGGTCTGGAGGGAGGCCCCCGTGATGAATCCCGTGAT
 86GAGCCGCCGATCCGAGCTCAGGCTGCGTCATGGGACCAGCCACAAGGTTG
 87CCTGACCTATAAAGGTCGCAGGAGTGCCTCAGGGACACAGAAGCAGTTAC
 88AGCTGCCAG
 89>hg17_chr14_98710240_98712285_-
 90GTAAAGATGAGCCTTCCAGCTACATTTGCACAACATGCAAGCAGCCCTTC
 91AACAGCGCGTGGTTCCTGCTGCAGCACGCGCAGAACACGCACGGCTTCCG
 92CATCTACCTGGAGCCCGGGCCGGCCAGCAGCTCGCTCACGCCGCGGCTCA
 93CCATCCCGCCGCCGCTCGGGCCGGAGGCCGTGGCGCAGTCCCCGCTCATG
 94AATTTCCTGGGCGACAGCAACCCCTTCAACCTGCTGCGCATGACGGGCCC
 95CATCCTGCGGGACCACCCGGGCTTCGGCGAGGGCCGCCTGCCGGGCACGC
 96CGCCTCTCTTCAGTCCCCCGCCGCGCCACCACCTGGACCCGCACCGCCTC
 97AGTGCCGAGGAGATGGGGCTCGTCGCCCAGCACCCCAGTGCCTTCGACCG
 98AGTCATGCGCCTGAACCCCATGGCCATCGACTCGCCCGCCATGGACTTCT
 99CGCGGCGGCTCCGCGAGCTGGCGGGCAACAGCTCCACGCCGCCGCCCGTG
100TCCCCGGGCCGCGGCAACCCTATGCACCGGCTCCTGAACCCCTTCCAGCC
101CAGCCCCAAGTCCCCGTTCCTGAGCACGCCGCCGCTGCCGCCCATGCCCC
102CTGGCGGCACGCCGCCCCCGCAGCCGCCAGCCAAGAGCAAGTCGTGCGAG
103TTCTGCGGCAAGACCTTCAAGTTCCAGAGCAATCTCATCGTGCACCGGCG
104CAGTCACACGGGCGAGAAGCCCTACAAGTGCCAGCTGTGCGACCACGCGT
105GCTCGCAGGCCAGCAAGCTCAAGCGCCACATGAAGACGCACATGCACAAG
106GCCGGCTCGCTGGCCGGCCGCTCCGACGACGGGCTCTCGGCCGCCAGCTC
107CCCCGAGCCCGGCACCAGCGAGCTGGCGGGCGAGGGCCTCAAGGCGGCCG
108ACGGTGACTTCCGCCACCACGAGAGCGACCCGTCGCTGGGCCACGAGCCg
109gaggaggaggacgaggaggaggaggaggaggaggaggagCTGCTACTGGA
110GAACGAGAGCCGGCCCGAGTCGAGCTTCAGCATGGACTCGGAGCTGAGCC
111GCAACCGCGAGAACGGCGGTGGTGGGGTgcccggggtcccgggcgcgggg
112ggcggcgcggccAAGGCGCTGGCTGACGAGAAGGCGCTGGTGCTGGGCAA
113GGTCATGGAGAACGTGGGCCTAGGCGCACTGCCGCAGTACGGCGAGCTCC
114TGGCCGACAAGCAGAAGCGCGGCGCCTTCCTGAAGCGTGCggcgggcggc
115ggggacgcgggcgacgacgacgacgcgggcggctgcggggacgcgggcgc
116gggcggcgcggtcaacgggcgcgggggcggCTTCGCGCCAGGCACCGAGC
117CCTTCCCCGGGCTCTTCCCGCGCAAGCCCGCGCCGCTGCCCAGCCCCGGG
118CTCAACAGCGCCGCCAAGCGCATCAAGGTGGAGAAGGACCTGGAGCTGCC
119GCCCGCCGCGCTCATCCCGTCCGAGAACGTGTACTCGCAGTGGCTGGTGG
120GCTACGCGGCGTCGCGGCACTTCATGAAGGACCCCTTCCTGGGCTTCACG
121GACGCACGACAGTCGCCCTTCGCCACGTCGTCCGAGCACTCGTCCGAGAA
122CGGCAGCCTGCGCTTCTCCACGCCGCCCGGGGACCTGCTGGACGGCGGCC
123TCTCGGGCCGCAGCGGCACGGCCAGCGGAGGCAGCACCCCGCACCTgggc
124ggcccgggccccgggcggcccAGCTCCAAGGAGGGCCGCCGCAGCGACAC
125GTGCGAGTACTGCGGCAAGGTGTTCAAGAACTGCAGCAACTTGACGGTGC
126ACCGGCGGAGCCACACCGGCGAGCGGCCTTACAAGTGCGAGCTGTGCAAC
127TACGCGTGCGCGCAGAGCAGCAAGCTCACGCGCCACATGAAGACGCACGG
128GCAGATCGGCAAGGAGGTGTACCGCTGCGACATCTGCCAGATGCCCTTCA
129GCGTCTACAGCACCCTGGAGAAACACATGAAAAAGTGGCACGGCGAGCAC
130TTGCTGACTAACGACGTCAAAATCGAGCAGGCCGAGAGGAGCTAA
131>hg17_chr15_41486872_41487060_-
132ATATTGCTTTAGGGGTATTTGATGTGGTGGTGACGGACCCCTCATGCCCA
133GCCTCGGTGCTGAAGTGTGCTGAAGCATTGCAGCTGCCTGTGGTGTCACA
134AGAGTGGGTGATCCAGTGCCTCATTGTTGGGGAGAGAATTGGATTCAAGC
135AGCATCCAAAATATAAACACGATTATGTTTCTCACTAA
136>hg17_chr15_41673708_41673857_+
137ATGGCTGGTCCCTTCTCCCGTCTGCTGTCCGCCCGCCCGGGACTCAGGCT
138CCTGGCTTTGGCCGGAGCGGGGTCTCTAGCCGCTGGGTTTCTGCTCCGAC
139CGGAACCTGTACGAGCTGCCAGTGAACGACGGAGGCTGTATCCCCCGAG
140>hg17_chr15_41679161_41679250_-
141GTCGAAGTACAGCCTGGGGCCTCCAGGACTGGTCACGACCTTCCTGGTCC
142CTGGTATTGACTATCAGCTTCCTTGGCCACCTGCTATGA
143>hg17_chr15_41826029_41826196_+
144ATGCGCCTCCGCCGCCTAGCGCTGTTCCCGGGTGTGGCGCTGCTTCTTGC
145CGCGGCCCGCCTCGCCGCTGCCTCCGACGTGCTAGAACTCACGGACGACA
146ACTTCGAGAGTCGCATCTCCGACACGGGCTCTGCGGGCCTCATGCTCGTC
147GAGTTCTTCGCCCCCTG
148>hg17_chr16_142908_143003_+
149ATGTCTCTGACCAAGACTGAGAGGACCATCATTGTGTCCATGTGGGCCAA
150GATCTCCACGCAGGCCGACACCATCGGCACCGAGACTCTGGAGAG
151>hg17_chr16_179963_180135_-
152GTCACGCTCCCGGGATCGGCGTCGGAGGCGGTCAAGATCTACCTCCCGAG
153AGCGACGGAAATTGTCCCGGTCCCGGTCCCGAGATAGACATCGGCGCCAC
154CGCAGCCGTTCCCGGAGCCACAGCCGGGGACATCGTCGGGCTTCCCGGGA
155CCGAAGTGCGAAATACAAGTAA
156>hg17_chr16_244413_244681_+
157ATGTTGGACCACAAGGACTTAGAGGCCGAAATCCACCCCTTGAAAAATGA
158AGAAAGAAAATCGCAGGAAAATCTGGGAAATCCATCAAAAAATGAGGATA
159ACGTGAAAAGCGCGCCTCCACAGTCCCGGCTCTCCCGGTGCCGAGCGGCG
160GCGTTTTTTCTTTCATTGTTTCTCTGCCTTTTTGTGGTGTTCGTCGTCTC
161ATTCGTCATCCCGTGTCCAGACCGGCCGGCGTCACAGCGAATGTGGAGGA
162TAGACTACAGTGCCGCTG
163>hg17_chr16_259268_259383_-
164CGTGTTCCCGTTTACGTGGAGGCCACGGCACTCGAGCCCCAGCCCTGCAC
165TCCTTCCCACCCCTGTGGAGCCCACAGCGGCTTGTGGCCCTGGGGGTGGA
166GATGGGGTGGCCTAG
167>hg17_chr18_23786114_23786321_-
168GGCCTTAAAGCGGCTGACAATGACCCCACAGCTCCACCATATGACTCCCT
169GTTAGTGTTTGACTATGAAGGCAGTGGCTCCACTGCTGGGTCCTTGAGCT
170CCCTTAATTCCTCAAGTAGTGGTGGTGAGCAGGACTATGATTACCTGAAC
171GACTGGGGGCCACGGTTCAAGAAACTTGCTGACATGTATGGTGGAGGTGA
172TGACTGA
173>hg17_chr18_59406881_59407046_+
174ATGGATTCACTTGGCGCCGTCAGCACTCGACTTGGGTTTGATCTTTTCAA
175AGAGCTGAAGAAAACAAATGATGGCAACATCTTCTTTTCCCCTGTGGGCA
176TCTTGACTGCAATTGGCATGGTCCTCCTGGGGACCCGAGGAGCCACCGCT
177TCCCAGTTGGAGGAG
178>hg17_chr18_59455932_59456337_-
179CTTGAAGAGAAACTCACTGCTGAGAAATTGATGGAATGGACAAGTTTGCA
180GAATATGAGAGAGACATGTGTCGATTTACACTTACCTCGGTTCAAAATGG
181AAGAGAGCTATGACCTCAAGGACACGTTGAGAACCATGGGAATGGTGAAT
182ATCTTCAATGGGGATGCAGACCTCTCAGGCATGACCTGGAGCCACGGTCT
183CTCAGTATCTAAAGTCCTACACAAGGCCTTTGTGGAGGTCACTGAGGAGG
184GAGTGGAAGCTGCAGCTGCCACCGCTGTAGTAGTAGTCGAATTATCATCT
185CCTTCAACTAATGAAGAGTTCTGTTGTAATCACCCTTTCCTATTCTTCAT
186AAGGCAAAATAAGACCAACAGCATCCTCTTCTATGGCAGATTCTCATCCC
187CATAG
188>hg17_chr18_59600586_59600754_+
189ATGGCCTCCCTTGCTGCAGCAAATGCAGAGTTTTGCTTCAACCTGTTCAG
190AGAGATGGATGACAATCAAGGAAATGGAAATGTGTTCTTTTCCTCTCTGA
191GCCTCTTCGCTGCCCTGGCCCTGGTCCGCTTGGGCGCTCAAGATGACTCC
192CTCTCTCAGATTGATAAG
193>hg17_chr19_59068595_59069564_+
194ATGCCAGTGACGGTAACCCGCACCACCATCACAACCACCACGACGTCATC
195TTCGGGCCTGGGGTCCCCCATGATCGTGGGGTCCCCTCGGGCCCTGACAC
196AGCCCCTGGGTCTCCTTCGCCTGCTGCAGCTGGTGTCTACCTGCGTGGCC
197TTCTCGCTGGTGGCTAGCGTGGGCGCCTGGACGGGGTCCATGGGCAACTG
198GTCCATGTTCACCTGGTGCTTCTGCTTCTCCGTGACCCTGATCATCCTCA
199TCGTGGAGCTGTGCGGGCTCCAGGCCCGCTTCCCCCTGTCTTGGCGCAAC
200TTCCCCATCACCTTCGCCTGCTATGCGGCCCTCTTCTGCCTCTCGGCCTC
201CATCATCTACCCCACCACCTATGTCCAGTTCCTGTCCCACGGCCGTTCGC
202GGGACCACGCCATCGCCGCCACCTTCTTCTCCTGCATCGCGTGTGTGGCT
203TACGCCACCGAAGTGGCCTGGACCCGGGCCCGGCCCGGCGAGATCACTGG
204CTATATGGCCACCGTACCCGGGCTGCTGAAGGTGCTGGAGACCTTCGTTG
205CCTGCATCATCTTCGCGTTCATCAGCGACCCCAACCTGTACCAGCACCAG
206CCGGCCCTGGAGTGGTGCGTGGCGGTGTACGCCATCTGCTTCATCCTAGC
207GGCCATCGCCATCCTGCTGAACCTGGGGGAGTGCACCAACGTGCTACCCA
208TCCCCTTCCCCAGCTTCCTGTCGGGGCTGGCCTTGCTGTCTGTCCTCCTC
209TATGCCACCGCCCTTGTTCTCTGGCCCCTCTACCAGTTCGATGAGAAGTA
210TGGCGGCCAGCCTCGGCGCTCGAGAGATGTAAGCTGCAGCCGCAGCCATG
211CCTACTACGTGTGTGCCTGGGACCGCCGACTGGCTGTGGCCATCCTGACG
212GCCATCAACCTACTGGCGTATGTGGCTGACCTGGTGCACTCTGCCCACCT
213GGTTTTTGTCAAGGTCTAA
214>hg17_chr19_59236026_59236146_-
215ACGGCAGACCCCCAAGGAGTGACCTATGCTGAGCTAAGCACCAGCGCCCT
216GTCTGAGGCAGCTTCAGACACCACCCAGGAGCCCCCAGGATCTCATGAAT
217ATGCGGCACTGAAAGTGTAG
218>hg17_chr19_59297998_59298008_+
219ATGGCTGCGA
220>hg17_chr19_59302168_59302288_-
221ATTAAGGTTGAGGAAGACTTTGGCTTTGAAGCAGATGAGGCCCTGGATTC
222CAGTTGGGTTTCTCGGGGTCCAGACAAACTGCTGCCCTACCCGACCCTGG
223CCAGCCCAGCCTCTGACTGA
224>hg17_chr2_118288583_118288668_+
225ATGTCACACCTGCCGATGAAACTCCTGCGTAAGAAGATCGAGAAGCGGAA
226CCTCAAATTGCGGCAGCGGAACCTAAAGTTTCAGG
227>hg17_chr2_118394148_118394202_-
228GAGGGCCGCAAGAACGAGATGCTGCTGTCCAAGGTGAAAGCGAAGGCCTC
229CTGA
230>hg17_chr2_220190202_220190242_+
231ATGCTCAAAGCGGTGATCCTGATTGGAGGCCCTCAAAAGG
232>hg17_chr2_220229609_220230869_-
233TGGGAGATCCAGAATACCAGCCATCTGGCCGTTGATGGGGACCAGGCAGC
234TGCTTGGCCCGTGGGTATTCCAGCACCATCCCGCCCGGCCTCCCGCTTTG
235AGGTGCTGCGCTGGGACTACTTCACGGAGCAGCACGCTTTCTCCTGCGCC
236GATGGCTCACCCCGCTGCCCACTGCGTGGGGCTGACCGGGCTGATGTGGC
237CGATGTTCTGGGGACAGCTCTAGAGGAGCTGAACCGCCGCTACCACCCGG
238CCTTGCGGCTCCAGAAGCAGCAGCTGGTGAATGGCTACCGACGCTTTGAT
239CCGGCCCGGGGTATGGAATACACGCTGGACTTGCAGCTGGAGGCACTGAC
240CCCCCAGGGAGGCCGCCGGCCCCTCACTCGCCGAGTGCAGCTGCTCCGGC
241CGCTGAGCCGCGTGGAGATCTTGCCTGTGCCCTATGTCACTGAGGCCTCA
242CGTCTCACTGTGCTGCTGCCTCTAGCTGCGGCTGAGCGTGACCTGGCCCC
243TGGCTTCTTGGAGGCCTTTGCCACTGCAGCACTGGAGCCTGGTGATGCTG
244CGGCAGCCCTGACCCTGCTGCTACTGTATGAGCCGCGCCAGGCCCAGCGC
245GTGGCCCATGCAGATGTCTTCGCACCTGTCAAGGCCCACGTGGCAGAGCT
246GGAGCGGCGTTTCCCCGGTGCCCGGGTGCCATGGCTCAGTGTGCAGACAG
247CCGCACCCTCACCACTGCGCCTCATGGATCTACTCTCCAAGAAGCACCCG
248CTGGACACACTGTTCCTGCTGGCCGGGCCAGACACGGTGCTCACGCCTGA
249CTTCCTGAACCGCTGCCGCATGCATGCCATCTCCGGCTGGCAGGCCTTCT
250TTCCCATGCATTTCCAAGCCTTCCACCCAGCTGTGGCCCCACCACAAGGG
251CCTGGGCCCCCAGAGCTGGGCCGTGACACTGGCCGCTTTGATCGCCAGGC
252AGCCAGCGAGGCCTGCTTCTACAACTCCGACTATGTGGCAGCCCGTGGGC
253GCCTGGCGGCAGCCTCAGAACAAGAAGAGGAGCTGCTGGAGAGCCTGGAT
254GTGTACGAGCTGTTCCTCCACTTCTCCAGTCTGCATGTGCTGCGGGCGGT
255GGAGCCGGCGCTGCTGCAGCGCTACCGGGCCCAGACGTGCAGCGCGAGGC
256TCAGTGAGGACCTGTACCACCGCTGCCTCCAGAGCGTGCTTGAGGGCCTC
257GGCTCCCGAACCCAGCTGGCCATGCTACTCTTTGAACAGGAGCAGGGCAA
258CAGCACCTGA
259>hg17_chr20_33330413_33330423_-
260CCTCACCTGA
261>hg17_chr20_33513606_33513792_+
262ATGGAGACAAGAAGCCCTGGGTTGAACAACATGAAGCCCCAGTCACTGCA
263GCTGGTACTGGAAGAGCAGGTGCTGGCACTACAGCAGCAGATGGCAGAGA
264ATCAGGCAGCCTCCTGGCGGAAGCTGAAGAACTCCCAGGAGGCCCAGCAG
265AGACAAGCAACCCTTGTGAGGAAGCTGCAGGCCAAG
266>hg17_chr20_33579500_33579527_-
267ATTTTGGAAGATGGTCTGGTTCCCTAG
268>hg17_chr20_33593260_33593348_+
269ATGGAGGCGCTGGGGAAGCTGAAGCAGTTCGATGCCTACCCCAAGACTTT
270GGAGGACTTCCGGGTCAAGACCTGCGGGGGCGCCACCG
271>hg17_chr21_32707032_32707192_+
272ATGCTTCTGCCGGGACGCGCACGCCAACCGCCGACGCCCCAGCCCGTGCA
273GCATCCCGGCCTCCGCCGGCAGGTAGAGCCGCCGGGGCAGCTCCTGCGCC
274TCTTCTACTGCACTGTCCTGGTCTGCTCCAAAGAGATCTCAGCGCTCACC
275GACTTCTCTG
276>hg17_chr21_32869641_32870022_-
277ATGGAGCGCCCTCTCATCTGGCACCTTCCTGGCCTCTTTCCCAGGCCCCA
278GTTCTGTCCATGCAGCTGTGGGTGCTTCCTGCATTGCGGGTCTCACGGGG
279AGGAGACGAGAGTGCCCCTGGTTGAGTCAGGAAAGAATTCTATCTTCACG
280TCGCTGCCAGCAAATGACCACAGCAGCTTCACGACCTCTGCAGGAACCTA
281TCTTGGTAAAGAAACGGGGCCTATGTGGTGGCCGAGCCTCAGGTGTGGCC
282GAGCTTCAGGTGTGGCCCTTATGCACAGCACAGCCCAAGCCTGTGGGCAC
283CACTCGCCCTGGGCTGCCTGGCACCTGGACTCCTTCCCATCCTTGGCCGA
284GGTCTGCGTGGCCCTTCAGGGCCGAATCTGA
285>hg17_chr21_33321040_33322012_+
286ATGGACTCGGACGCCAGCCTGGTGTCCAGCCGCCCGTCGTCGCCAGAGCC
287CGATGACCTTTTTCTGCCGGCCCGGAGTAAGGGCAGCAGCGGCAGCGCCT
288TCACTGGGGGCACCGTGTCCTCGTCCACCCCGAGTGACTGCCCGCCGGAG
289CTGAGCGCCGAGCTGCGCGGCGCTATGGGCTCTGCGGGCGCGCATCCTGG
290GGACAAGCTAGGAGGCAGTGGCTTCAAGTCATCCTCGTCCAGCACCTCGT
291CGTCTACGTCGTCGGCGGCTGCGTCGTCCACCAAGAAGGACAAGAAGCAA
292ATGACAGAGCCGGAGCTGCAGCAGCTGCGTCTCAAGATCAACAGCCGCGA
293GCGCAAGCGCATGCACGACCTCAACATCGCCATGGATGGCCTCCGCGAGG
294TCATGCCGTACGCACACGGCCCTTCGGTGCGCAAGCTTTCCAAGATCGCC
295ACGCTGCTGCTGGCGCGCAACTACATCCTCATGCTCACCAACTCGCTGGA
296GGAGATGAAGCGACTGGTGAGCGAGATCTACGGGGGCCACCACGCTGGCT
297TCCACCCGTCGGCCTGCGGCGGCCTGGCGCACTCCGCGCCCCTGCCCGCC
298GCCACCGCGCACCCGGCAGCAGCAGCGCACGCCGCACATCACCCCGCGGT
299GCACCACCCCATCctgccgcccgccgccgcagcggctgctgccgccgctg
300cagccgcggctgTGTCCAGCGCCTCTCTGCCCGGATCCGGGCTGCCGTCG
301GTCGGCTCCATCCGTCCACCGCACGGCCTACTCAAGTCTCCGTCTGCTgc
302cgcggccgccccgctggggggcgggggcggcggcAGTGGGGCGAGCGGGG
303GCTTCCAGCACTGGGGCGGCATGCCCTGCCCCTGCAGCATGTGCCAGGTG
304CCGCCGCCGCACCACCACGTGTCGGCTATGGGCGCCGGCAGCCTGCCGCG
305CCTCACCTCCGACGCCAAGTGA
306>hg17_chr21_33744994_33745040_-
307CACTCTGATCTACAAATTTGGAAGAACCGAAGAGCTATGGACCTGA
308>hg17_chr22_30120223_30120265_+
309ATGAGCAGCACCTTAGCTAAGATCGCGGAGATAGAAGCAGAG
310>hg17_chr22_30160419_30160661_-
311TTCTGCATCCTCCAGGCTCTGGTTCCCATGCAGCAGCTGTCAGCGTTCAG
312ACAACCCCTCAGAACGTGCCCAGCCGGTCAGGCCTGCCCCACATGCACTC
313CCAGCTGGAGCATCGCCCCAGCCAGAGGAGCAGCTCCCCTGTGGGCCTTG
314CCAAATGGTTTGGCTCAGATGTGCTACAGCAACCCCTGCCCTCCATGCCC
315GCCAAAGTTATCAGTGTAGATGAATTGGAATACCGACAGTGA
316>hg17_chr22_30665273_30665360_+
317ATGGGGGACCGGGAGCAGCTGCTGCAGCGGGCGCGGCTGGCCGAGCAGGC
318GGAGCGCTACGACGACATGGCCTCCGCTATGAAGGCG
319>hg17_chr22_30939054_30939266_-
320ATTATCCTGAGAAATCACGTGGATGCCTCAAGAAAGCTTATGACTTGTTC
321TGCGGTTTGCAGAAGGGACCCAAGCTAACCAAGGAGGAGGAGGAAGCCTT
322GAGCAAGAAGCTCACAGACACGTCTGAGAGGCCCTCGTGGAGGACAATAG
323TGAACATCAACGCCATCCTCCTCCTGGCTGTGGTGGTCTTTATTCACGGC
324TACTATGCCTGA
325>hg17_chr5_131424298_131424460_+
326ATGAGCCGCCTGCCCGTCCTGCTCCTGCTCCAACTCCTGGTCCGCCCCGG
327ACTCCAAGCTCCCATGACCCAGACAACGCCCTTGAAGACAAGCTGGGTTA
328ACTGCTCTAACATGATCGATGAAATTATAACACACTTAAAGCAGCCACCT
329TTGCCTTTGCTG
330>hg17_chr5_131556601_131556672_-
331TCTCCAATAAGTGGTTCCATGAACGAGGACAGGAGTTCTTGAGACCTTGT
332GGATCAACAGAAGTTGACTGA
333>hg17_chr5_131621326_131621419_+
334ATGCCCCATTCCGTGACCCTGCGCGGGCCTTCGCCCTGGGGCTTCCGCCT
335GGTGGGCGGCCGGGACTTCAGCGCGCCCCTCACCATCTCACGG
336>hg17_chr5_131847541_131847666_-
337GGGATATTGGGCTGAGTCTACAGCGTGTCTTCACAGATCTGAAGAACATG
338GATGCCACCTGGCTGGACAGCCTGCTGACCCCAGTCCGGTTGCCCTCCAT
339CCAGGCCATTCCCTGTGCACCGTAG
340>hg17_chr6_108299600_108299744_-
341TTGGAAGTTCATGAGGCTAAGCCTGTGCCAGAAAATCACCCACAGTGGGA
342TACAGCAATAGAGGGGGATGAAGACCAGGAGGACAGTGAGGGCTTTGAAG
343ATAGCTTTGAGGAAGAAGAGGAGGAAGAAGAAGATGATGACTAA
344>hg17_chr6_108594662_108594687_+
345ATGAGCAAGCCAGCCGGATCAACAA
346>hg17_chr6_108640045_108640151_-
347GGTCGCTGGTCATCCTCTGGCACAGAACGAACGTTGTCTTCACATGTTTT
348TACAAGATGAAATAATAGATAAAAGCTATACTCCATCTAAAATAAGACAT
349GCCTGA
350>hg17_chr6_108722976_108723115_+
351ATGGCGGCCTCCTGGTCGCTCTTGGTTACCCTGCGCCCCTTAGCACAGAG
352CCCGCTGAGAGGGAGATGTGTTGGGTGCGGGGCCTGGGCCGCCGCTCTCG
353CTCCTCTGGCCACCGCCCCTGGGAAGCCCTTTTGGAAAG
354>hg17_chr7_113660517_113660685_+
355ATGATGCAGGAATCTGCGACAGAGACAATAAGCAACAGTTCAATGAATCA
356AAATGGAATGAGCACTCTAAGCAGCCAATTAGATGCTGGCAGCAGAGATG
357GAAGATCAAGTGGTGACACCAGCTCTGAAGTAAGCACAGTAGAACTGCTG
358CATCTGCAACAACAGCAG
359>hg17_chr7_116512159_116512389_-
360GCTCCCTGGGTACAGCAGGCCGTGTGTGCAACCTGACTTCCCGGGGCATG
361GACAGCTGTGAAGTCATGTGCTGTGGGAGAGGCTACGACACCTCCCATGT
362CACCCGGATGACCAAGTGTGGGTGTAAGTTCCACTGGTGCTGCGCCGTGC
363GCTGTCAGGACTGCCTGGAAGCTCTGGATGTGCACACATGCAAGGCCCCC
364AAGAACGCTGACTGGACAACCGCTACATGA
365>hg17_chr7_116714099_116714152_+
366ATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTCTCCAAACTTTTTTT
367CAG
368>hg17_chr7_116945541_116945787_-
369GAGGTCAGTCCTCTCAGCAGCCATCAAACTACTGAATGCAGCAACAGTAA
370ATCAAAGACTGAGTTGGGTGTTTCAAGAGTTAAATCTTTTCTTCCTGTTC
371CTAGAAGTAAAGTCACCCAGTGTTCCCAGAACACCAAAAGAAGCAGCAGC
372AGCAGTAATACAAGGCAAATAGAAATCAACAACAACTCAAAAGAAGTGAA
373TTGGAACTTACACAAAAATGAACACCTAGAAAAACCTAACAAATAG
374>hg17_chr8_118881131_118881317_-
375ACTTCTCGGGCTTCCCGTTGGGCTGACCCTGACCACTTTGCCCAGCGACA
376GAGCTGCATGAATACGTTTGCCAGCTGGTTTGGCTACATGCCGCTGATCC
377ACTCTCAGATGAGGCTCGACCCCGTCCTCTTTAAAGACCAGGTCTCTATT
378TTGAGGAAGAAATACCGAGACATTGAGCGACTTTGA
379>hg17_chr9_128764156_128764189_+
380ATGGCCTGCCTGAGCCCCTCGCAGCTCCAGAAG
381>hg17_chr9_128787519_128789136_-
382ATGACCCGAGAGTGCCCATCTCCGGCCCCGGGGCCTGGGGCTCCGCTGAG
383TGGATCGGTGCTGGCAGAGGCGGCAGTAGTGTTTGCAGTGGTGCTGAGCA
384TCCACGCAACCGTATGGGACCGATACTCGTGGTGCGCCGTGGCCCTCGCA
385GTGCAGGCCTTCTACGTCCAATACAAGTGGGACCGGCTGCTACAGCAGGG
386AAGCGCCGTCTTCCAGTTCCGAATGTCCGCAAACAGTGGCCTATTGCCCG
387CCTCCATGGTCATGCCTTTGCTTGGACTAGTCATGAAGGAGCGGTGCCAG
388ACTGCTGGGAACCCGTTCTTTGAGCGTTTTGGCATTGTGGTGGCAGCCAC
389TGGCATGGCAGTGGCCCTCTTCTCATCAGTGTTGGCGCTCGGCATCACTC
390GCCCAGTGCCAACCAACACTTGTGTCATCTTGGGCTTGGCTGGAGGTGTT
391ATCATTTATATCATGAAGCACTCGTTGAGCGTGGGGGAGGTGATCGAAGT
392CCTGGAAGTCCTTCTGATCTTCGTTTATCTCAACATGATCCTGCTGTACC
393TGCTGCCCCGCTGCTTCACCCCTGGTGAGGCACTGCTGGTATTGGGTGGC
394ATTAGCTTTGTCCTCAACCAGCTCATCAAGCGCTCTCTGACACTGGTGGA
395AAGTCAGGGGGACCCAGTGGACTTCTTCCTGCTGGTGGTGGTAGTAGGGA
396TGGTACTCATGGGCATTTTCTTCAGCACTCTGTTTGTCTTCATGGACTCA
397GGCACCTGGGCCTCCTCCATCTTCTTCCACCTCATGACCTGTGTGCTGAG
398CCTTGGTGTGGTCCTACCCTGGCTGCACCGGCTCATCCGCAGGAATCCCC
399TGCTCTGGCTTCTTCAGTTTCTCTTCCAGACAGACACCCGCATCTACCTC
400CTAGCCTATTGGTCTCTGCTGGCCACCTTGGCCTGCCTGGTGGTGCTGTA
401CCAGAATGCCAAGCGGTCATCTTCCGAGTCCAAGAAGCACCAGGCCCCCA
402CCATCGCCCGAAAGTATTTCCACCTCATTGTGGTAGCCACCTACATCCCA
403GGTATCATCTTTGACCGGCCACTGCTCTATGTAGCCGCCACTGTATGCCT
404GGCGGTCTTCATCTTCCTGGAGTATGTGCGCTACTTCCGCATCAAGCCTT
405TGGGTCACACTCTACGGAGCTTCCTGTCCCTTTTTCTGGATGAACGAGAC
406AGTGGACCACTCATTCTGACACACATCTACCTGCTCCTGGGCATGTCTCT
407TCCCATCTGGCTGATCCCCAGACCCTGCACACAGAAGGGTAGCCTGGGAG
408GAGCCAGGGCCCTCGTCCCCTATGCCGGTGTCCTGGCTGTGGGTGTGGGT
409GATACTGTGGCCTCCATCTTCGGTAGCACCATGGGGGAGATCCGCTGGCC
410TGGAACCAAAAAGACTTTTGAGGGGACCATGACATCTATATTTGCGCAGA
411TCATTTCTGTAGCTCTGATCTTAATCTTTGACAGTGGAGTGGACCTAAAC
412TACAGTTATGCTTGGATTTTGGGGTCCATCAGCACTGTGTCCCTCCTGGA
413AGCATACACTACACAGATAGACAATCTCCTTCTGCCTCTCTACCTCCTGA
414TATTGCTGATGGCCTAG
415>hg17_chr9_128882427_128882523_+
416ATGGCGTTCCGGAGGGCCGAGGGCACGTCTATGATCCAGGCCCTGGCCAT
417GACGGTGGCCGAGATCCCCGTGTTCCTGTACACGACGTTTGGGCAG
418>hg17_chr9_128937229_128937445_-
419GTCCCTGCCAAGACAGACTGTGTCATGTTCTTCGGGCCCGTGGTCCCCGA
420CGGCTACGGTGTCTGCTATAACCCCATGGAGGCCCACATCAACTTCTCCC
421TGTCGGCCTACAACAGCTGCGCGGAGACCAACGCCGCCCGCCTGGCGCAT
422TACCTGGAGAAGGCGCTCCTGGACATGCGTGCCCTGCTGCAGAGCCACCC
423CCGGGCCAAGCTCTGA
424>hg17_chrX_122745047_122745924_+
425ATGACTTTTAACAGTTTTGAAGGATCTAAAACTTGTGTACCTGCAGACAT
426CAATAAGGAAGAAGAATTTGTAGAAGAGTTTAATAGATTAAAAACTTTTG
427CTAATTTTCCAAGTGGTAGTCCTGTTTCAGCATCAACACTGGCACGAGCA
428GGGTTTCTTTATACTGGTGAAGGAGATACCGTGCGGTGCTTTAGTTGTCA
429TGCAGCTGTAGATAGATGGCAATATGGAGACTCAGCAGTTGGAAGACACA
430GGAAAGTATCCCCAAATTGCAGATTTATCAACGGCTTTTATCTTGAAAAT
431AGTGCCACGCAGTCTACAAATTCTGGTATCCAGAATGGTCAGTACAAAGT
432TGAAAACTATCTGGGAAGCAGAGATCATTTTGCCTTAGACAGGCCATCTG
433AGACACATGCAGACTATCTTTTGAGAACTGGGCAGGTTGTAGATATATCA
434GACACCATATACCCGAGGAACCCTGCCATGTATAGTGAAGAAGCTAGATT
435AAAGTCCTTTCAGAACTGGCCAGACTATGCTCACCTAACCCCAAGAGAGT
436TAGCAAGTGCTGGACTCTACTACACAGGTATTGGTGACCAAGTGCAGTGC
437TTTTGTTGTGGTGGAAAACTGAAAAATTGGGAACCTTGTGATCGTGCCTG
438GTCAGAACACAGGCGACACTTTCCTAATTGCTTCTTTGTTTTGGGCCGGA
439ATCTTAATATTCGAAGTGAATCTGATGCTGTGAGTTCTGATAGGAATTTC
440CCAAATTCAACAAATCTTCCAAGAAATCCATCCATGGCAGATTATGAAGC
441ACGGATCTTTACTTTTGGGACATGGATATACTCAGTTAACAAGGAGCAGC
442TTGCAAGAGCTGGATTTTATGCTTTAG
443>hg17_chrX_152648964_152649196_-
444TGACAACGAGGAGAAGGCCTTTGGCAGCAGCCAGCCATCGCTCAACGGGG
445ACATCAAGCCCCTGGGCAGTGACGACAGCCTGGCCGATTATGGGGGCAGC
446GTGGATGTTCAGTTCAACGAGGATGGTTCGTTCATTGGCCAGTACAGTGG
447CAAGAAGGAGAAGGAGGCGGCAGGGGGCAATGACAGCTCAGGGGCCACTT
448CCCCCATCAACCCTGCCGTGGCCCTAGAATAG
449>hg17_chrX_152691446_152691471_+
450ATGCTCATGGCGTCCACCACTTCCG
451>hg17_chrX_152694029_152694263_-
452GCTGTGGCACAGAACATGGACTCTGTGTTTAAGGAGCTCTTGGGAAAGAC
453CTCTGTCCGCCAGGGCCTTGGGCCAGCATCTACCACCTCTCCCAGTCCTG
454GGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGAACAAA
455GGCTTCTCCCGGGGCCCTGGGGCCCCAGCCTCACCCTCAGCTTCCCACCC
456CCAGGGCCTAGACACGACCCCCAAGCCACACTGA