/test-data/misc_dna_as_sanger_rev_comp_1.fastqsanger

https://bitbucket.org/cistrome/cistrome-harvard/ · Unknown · 16 lines · 16 code · 0 blank · 0 comment · 0 complexity · fa4324b14b55787b0e14e3705aaa45bc MD5 · raw file

  1. @FAKE0007 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order)
  2. TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
  3. +
  4. IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
  5. @FAKE0008 Original version has mixed case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order)
  6. cgCTatgAcgCTatgAcgCTatgAcgCTatgAcgCTatgAc
  7. +
  8. IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
  9. @FAKE0009 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order)
  10. actgactgactgactgactgactgactgactgactgactga
  11. +
  12. IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
  13. @FAKE0010 Original version has mixed case ambiguous DNA and PHRED scores of 40, 30, 20, 10 (cycled)
  14. NHBVDMKSWRYGATCnhbvdmkswrygatc
  15. +
  16. ?I+5?I+5?I+5?I+5?I+5?I+5?I+5?I