/test-data/misc_dna_as_sanger_rev_comp_1.fastqsanger
Unknown | 16 lines | 16 code | 0 blank | 0 comment | 0 complexity | fa4324b14b55787b0e14e3705aaa45bc MD5 | raw file
1@FAKE0007 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) 2TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT 3+ 4IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! 5@FAKE0008 Original version has mixed case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) 6cgCTatgAcgCTatgAcgCTatgAcgCTatgAcgCTatgAc 7+ 8IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! 9@FAKE0009 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) 10actgactgactgactgactgactgactgactgactgactga 11+ 12IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! 13@FAKE0010 Original version has mixed case ambiguous DNA and PHRED scores of 40, 30, 20, 10 (cycled) 14NHBVDMKSWRYGATCnhbvdmkswrygatc 15+ 16?I+5?I+5?I+5?I+5?I+5?I+5?I+5?I