PageRenderTime 7ms CodeModel.GetById 1ms app.highlight 3ms RepoModel.GetById 1ms app.codeStats 0ms

/test-data/misc_dna_as_sanger_rev_comp_1.fastqsanger

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 16 lines | 16 code | 0 blank | 0 comment | 0 complexity | fa4324b14b55787b0e14e3705aaa45bc MD5 | raw file
 1@FAKE0007 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order)
 2TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
 3+
 4IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
 5@FAKE0008 Original version has mixed case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order)
 6cgCTatgAcgCTatgAcgCTatgAcgCTatgAcgCTatgAc
 7+
 8IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
 9@FAKE0009 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order)
10actgactgactgactgactgactgactgactgactgactga
11+
12IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
13@FAKE0010 Original version has mixed case ambiguous DNA and PHRED scores of 40, 30, 20, 10 (cycled)
14NHBVDMKSWRYGATCnhbvdmkswrygatc
15+
16?I+5?I+5?I+5?I+5?I+5?I+5?I+5?I