/test-data/misc_dna_as_sanger_rev_comp_1.fastqsanger
https://bitbucket.org/cistrome/cistrome-harvard/ · Unknown · 16 lines · 16 code · 0 blank · 0 comment · 0 complexity · fa4324b14b55787b0e14e3705aaa45bc MD5 · raw file
- @FAKE0007 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order)
- TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
- +
- IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
- @FAKE0008 Original version has mixed case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order)
- cgCTatgAcgCTatgAcgCTatgAcgCTatgAcgCTatgAc
- +
- IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
- @FAKE0009 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order)
- actgactgactgactgactgactgactgactgactgactga
- +
- IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
- @FAKE0010 Original version has mixed case ambiguous DNA and PHRED scores of 40, 30, 20, 10 (cycled)
- NHBVDMKSWRYGATCnhbvdmkswrygatc
- +
- ?I+5?I+5?I+5?I+5?I+5?I+5?I+5?I