PageRenderTime 19ms CodeModel.GetById 13ms app.highlight 2ms RepoModel.GetById 2ms app.codeStats 0ms

/test-data/short_reads_trim_seq_out2.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 62 lines | 62 code | 0 blank | 0 comment | 0 complexity | 9622c940360649f2ea4dfe9aca7d94dd MD5 | raw file
 1>0
 2GACTCATGATTTCTTACCTATTAGTGGTTGAACA
 3>1
 4GTGATATGTATGTTGA
 5>2
 6GTTGTCGATAGAACTTCATGTG
 7>3
 8ACCAACCAGAACGTGAAAAAG
 9>4
10GTTTATGTTGGTTTCATGGTTT
11>5
12GCTTTACCGTCTTTCCAGAAATTGTTCCAAGTATCG
13>6
14GCTTGTTTACGAATTAAATCGAAGTGGACTGCTG
15>7
16GTTATAACGCCGAAGCGGTAAAAATTTTTATTTTTT
17>8
18GTTCTCACTTCTGTTACTCCAGCTTCTTCGGCACCT
19>9
20GTGGCCTGTTGAT
21>10_0
22GTGACCG
23>10_1
24ATAAAGT
25>11
26TCGCTACACGCAGGA
27>12
28GCTCGTTATGGTTTCCGTTGCTGCCATCTCAAAAAC
29>13
30GTTGACGGCCATAAGGCTG
31>14
32GTCAAGGACTGGTTTAGATATGAGTCACATTTTGTT
33>15
34GTGCTGAGTTTTTTTCTGTTACTGTG
35>16
36GACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGG
37>17
38GGAAAATGAGAAAATTCGACCTATCCTTGCGCAGCT
39>18
40GAGTCTCATTTTGCATCTCGGCAATCTCTTTCTGAT
41>19
42GTCATAAGAGGTTTTACCTCCAAATGAAGAAATAAC
43>20
44GCTGGTAATGGTGGTTTTTTTTTTTTTTTTTTT
45>21
46GTTGAGGCTTGCGTTTATGGTACGCTGGACTTT
47>22
48CAAGGT
49>23
50GGCGACTTCACGCCAGAATACGAAA
51>24
52GCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGA
53>25
54GGGATGAACATAATAAGCAATGACG
55>26
56GTATTTTACCAATGACCAAATCAAAGAAATGACTCG
57>27
58GTTTTTAGTGAGTTGTTCCATTCTTTAGCTCCTAGA
59>28
60AAGCTGTTGCCGA
61>29
62GCGTACTTATTCGCCACCATGATTATTAC