PageRenderTime 12ms CodeModel.GetById 8ms app.highlight 1ms RepoModel.GetById 2ms app.codeStats 0ms

/test-data/3.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 50 lines | 50 code | 0 blank | 0 comment | 0 complexity | 3c340023a5b8924cfc491973979d83d5 MD5 | raw file
 1>HSFAU1
 2ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
 3agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
 4cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
 5tcctggcaggccccctggaggatgaggccactctgggccagtgcggggtggaggccc
 6tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc
 7gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
 8agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
 9cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
10tctaataaaaaagccacttagttcagtcaaaaaaaaaa
11>HSFAU2
12ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
13agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
14cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
15tcctggcaggcgcgcccctggaggatgcactctgggccagtgcggggtggaggccc
16tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc
17gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
18agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
19cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
20tctaataaaaaagccacttagttcagtcaaaaaaaaaa
21>HSFAU3
22ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
23agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
24cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
25tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc
26tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc
27gtgctggaaaagtgagaggtcagactcctaagggggccaaacaggagaagaagaagaaga
28agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
29cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
30tctaataaaaaagccacttagttcagtcaaaaaaaaaa
31>HSFAU4
32ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
33agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
34cccagatcaaggctcatgaaatagcctcactggagggcattgccccggaagatcaagtcgtgc
35tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc
36tgactaccctggaagtagcaggccgcatgcttgcccgaggtaaagttcatggttccctggccc
37gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
38agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
39cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
40tctaataaaaaagccacttagttcagtcaaaaaaaaaa
41>HSFAU5
42ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
43agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
44cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
45tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc
46tgactaccctggaagtaggccgcatgctttttggaggtaaagttcatggttccctggccc
47gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
48agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
49cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
50tctaataaaaaagccacttagttcagtcaaaaaaaaaa