PageRenderTime 70ms CodeModel.GetById 65ms app.highlight 2ms RepoModel.GetById 1ms app.codeStats 0ms

/test-data/fastx_artifacts1.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 24 lines | 24 code | 0 blank | 0 comment | 0 complexity | 722a9cd09f3422cd4afbad39bb72a157 MD5 | raw file
 1>CSHL_3_FC0420AGLLKK:2:1:233:1674
 2GTTAGAGGGAATACACCCACTCTGTAGGCACCATC
 3>CSHL_3_FC0420AGLLKK:2:1:237:1037
 4GTGATAGATTGTCTTGTTGTTCTGTAGGCACCATC
 5>CSHL_3_FC0420AGLLKK:2:1:1601:1525
 6AAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAA
 7>CSHL_3_FC0420AGLLKK:2:1:1805:1464
 8GATGCGTTCGAGATGGGTGCGCTGTAGGCACCATC
 9>CSHL_3_FC0420AGLLKK:2:1:1713:528
10AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
11>CSHL_3_FC0420AGLLKK:2:1:126:1087
12GAGATATTCGAATGCATCATCAGATGGCACCATCA
13>CSHL_3_FC0420AGLLKK:2:1:1488:1323
14GTTTTTTCCCCTAATCTGAGTCTGTAGGCACCATC
15>CSHL_3_FC0420AGLLKK:2:1:1236:1157
16AAAAAAAAAAAAAAAACAAAAAAAAAAAAAACAAA
17>CSHL_3_FC0420AGLLKK:2:1:727:1020
18GTAATATAGTTGATAAGAATCTGCAGAGAGAATCA
19>CSHL_3_FC0420AGLLKK:2:1:758:1799
20GTAGAGACCCCCTAATAGAGTCTGTAGGCACCATC
21>CSHL_3_FC0420AGLLKK:2:1:1818:550
22AAAAAAAAAAAAAAAACAAAAACAAAAAAAACAAA
23>CSHL_3_FC0420AGLLKK:2:1:1764:391
24CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC