PageRenderTime 17ms CodeModel.GetById 15ms app.highlight 0ms RepoModel.GetById 2ms app.codeStats 0ms

/test-data/tabular_to_fasta_out1.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 60 lines | 60 code | 0 blank | 0 comment | 0 complexity | a9908e4d8b31d50e3ab3e042bd64097f MD5 | raw file
 1>5_300_902_419
 2GACTCATGATTTCTTACCTATTAGTGGTTGAACATC
 3>5_300_880_431
 4GTGATATGTATGTTGACGGCCATAAGGCTGCTTCTT
 5>5_300_896_461
 6GTTGTCGATAGAACTTCATGTGCCTGTAAAACAAGT
 7>5_300_890_751
 8ACCAACCAGAACGTGAAAAAGCGTCCTGCGTGTAGC
 9>5_300_897_443
10GTTTATGTTGGTTTCATGGTTTTGTCTAACTTTATC
11>5_300_906_879
12GCTTTACCGTCTTTCCAGAAATTGTTCCAAGTATCG
13>5_300_894_484
14GCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGC
15>5_300_890_811
16GTTATAACGCCGAAGCGGTAAAAATTTTTATTTTTT
17>5_300_889_530
18GTTCTCACTTCTGTTACTCCAGCTTCTTCGGCACCT
19>5_300_898_886
20GTGGCCTGTTGATTCTAAAGGTTAGTTTCTTCACGC
21>5_300_878_205
22GTGACCGCATAAAGTGCACAACATGGAAATGAGGAC
23>5_300_920_381
24GCAGATCGCTACACGCAGGACGCTTTTTCACGTTCT
25>5_300_886_453
26GCTCGTTATGGTTTCCGTTGCTGCCATCTCAAAAAC
27>5_300_893_365
28GTTGACGGCCATAAGGCTGCTTCTGACGTTCGTGAT
29>5_300_892_801
30GTCAAGGACTGGTTTAGATATGAGTCACATTTTGTT
31>5_300_881_945
32GTGCTGAGTTTTTTTCTGTTACTGTGACATTAATTT
33>5_300_883_811
34GACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGG
35>5_300_899_654
36GGAAAATGAGAAAATTCGACCTATCCTTGCGCAGCT
37>5_300_883_644
38GAGTCTCATTTTGCATCTCGGCAATCTCTTTCTGAT
39>5_300_879_877
40GTCATAAGAGGTTTTACCTCCAAATGAAGAAATAAC
41>5_300_900_821
42GCTGGTAATGGTGGTTTTTTTTTTTTTTTTTTTTTT
43>5_300_886_965
44GTTGAGGCTTGCGTTTATGGTACGCTGGACTTTGTA
45>5_300_933_442
46GAGGAGAGTGCAGGTATTAATATCAAGGTTTGTGAG
47>5_300_879_782
48GGCGACTTCACGCCAGAATACGAAATACCAGGTATT
49>5_300_923_441
50GCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGA
51>5_300_877_772
52GGGATGAACATAATAAGCAATGACGGCAGCAATAAA
53>5_300_918_831
54GTATTTTACCAATGACCAAATCAAAGAAATGACTCG
55>5_300_904_940
56GTTTTTAGTGAGTTGTTCCATTCTTTAGCTCCTAGA
57>5_300_956_880
58GTATTGATAAAGCTGTTGCCGATACTTAGCACTATT
59>5_300_883_755
60GCGTACTTATTCGCCACCATGATTATTACCAGTGTT