PageRenderTime 133ms CodeModel.GetById 90ms app.highlight 17ms RepoModel.GetById 2ms app.codeStats 0ms

/test-data/b1.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 1000 lines | 1000 code | 0 blank | 0 comment | 0 complexity | b75aca86231128bd519d55bc816ef606 MD5 | raw file
   1>HWI-EAS91_1_306UPAAXX:6:1:1503:1160
   2GGTGGTCTATAGTGTTATTAATATCAAGTTGGGGGG
   3>HWI-EAS91_1_306UPAAXX:6:1:1564:1179
   4GCGAGCAGTAGACTCCTTCTGTTGATAAGCAAGCAT
   5>HWI-EAS91_1_306UPAAXX:6:1:1704:1082
   6GATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTC
   7>HWI-EAS91_1_306UPAAXX:6:1:1588:1797
   8GTATGTTTCTCCTGCTTATCACCTTCTTGAAGGCTT
   9>HWI-EAS91_1_306UPAAXX:6:1:1304:1526
  10GTAGTTGAAATGGTAATAAGACGACCAATCTGACCT
  11>HWI-EAS91_1_306UPAAXX:6:1:1490:1582
  12GTCGTGTTCAACAGACCTATAAACATTCTGTGCCGC
  13>HWI-EAS91_1_306UPAAXX:6:1:1356:1339
  14GTAGACATTTTTACTTTTTATGTCCCTCATCGTCAC
  15>HWI-EAS91_1_306UPAAXX:6:1:1311:853
  16GGTTGGTTTATCGTTTTTGACACTCTCACGTTGTCT
  17>HWI-EAS91_1_306UPAAXX:6:1:1257:1552
  18GTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTC
  19>HWI-EAS91_1_306UPAAXX:6:1:1486:1402
  20GTTACTGAGAAGTTAATGGATGAATTGGCACAATGC
  21>HWI-EAS91_1_306UPAAXX:6:1:1028:1081
  22GGATTGGTTTCGCTGAATCAGGTTATTAAAGAGATT
  23>HWI-EAS91_1_306UPAAXX:6:1:1167:752
  24GGTTTTCTTCATTGCATTCAGATGGATACATCTGTC
  25>HWI-EAS91_1_306UPAAXX:6:1:1507:1113
  26GTCAACGTTATATTTTGATAGTTTGACGGTTAATTC
  27>HWI-EAS91_1_306UPAAXX:6:1:1654:1311
  28GGATGAAAATGCTCACAATGACAAATCTGTCCACGG
  29>HWI-EAS91_1_306UPAAXX:6:1:1386:1060
  30GTTCTTGGTCAGTATGCAAATTAGCATAAGCAGCTT
  31>HWI-EAS91_1_306UPAAXX:6:1:1070:1356
  32GGTTACAGTATGCCCATCGCAGTTCGCTACACGCAG
  33>HWI-EAS91_1_306UPAAXX:6:1:787:1032
  34GCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCA
  35>HWI-EAS91_1_306UPAAXX:6:1:834:1017
  36GCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGT
  37>HWI-EAS91_1_306UPAAXX:6:1:1703:1155
  38GGATTGGTTTCGCTGAATCAGGTTATTAAAGAGATT
  39>HWI-EAS91_1_306UPAAXX:6:1:1406:593
  40GTTGAGTTCGATAATGGTGATATGTATGTTTACGGC
  41>HWI-EAS91_1_306UPAAXX:6:1:1411:886
  42GTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCAT
  43>HWI-EAS91_1_306UPAAXX:6:1:923:972
  44GCATGACAAGTAAAGGACGGTTGTCAGCGTCATAAG
  45>HWI-EAS91_1_306UPAAXX:6:1:1279:1004
  46GCCATAGCACCAGAAACAAAACTAGGGGCGGCCTCT
  47>HWI-EAS91_1_306UPAAXX:6:1:1070:840
  48GGTTGTCAGCGTCATAAGAGGTTTTACCTCCAAATG
  49>HWI-EAS91_1_306UPAAXX:6:1:1595:1040
  50GTTTCTGATAAGTTGCTTGATTTGGTTGGACTTGGT
  51>HWI-EAS91_1_306UPAAXX:6:1:1002:559
  52GAGATTGCCGAGATGCAAAATGAGACTCAAAAAGAG
  53>HWI-EAS91_1_306UPAAXX:6:1:999:974
  54GTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGC
  55>HWI-EAS91_1_306UPAAXX:6:1:896:982
  56GTGGCTGGAGACAAATAATCTCTTTAATAACCTTAT
  57>HWI-EAS91_1_306UPAAXX:6:1:1366:741
  58GTTCAAGATTGCTGGAGGCCTCCACTATGAAATCGC
  59>HWI-EAS91_1_306UPAAXX:6:1:749:1469
  60GTTTATGGTGAACAGTGGATTAAGTTCATGAAGGAT
  61>HWI-EAS91_1_306UPAAXX:6:1:1010:592
  62GAGTTTATTGCTGCCGTCATTGCTTATTATGTTCAT
  63>HWI-EAS91_1_306UPAAXX:6:1:1393:650
  64GTGACTCATATCTAAACCAGTCCTTGACGAACGTGC
  65>HWI-EAS91_1_306UPAAXX:6:1:1238:1731
  66GAGAAATAAAAGTCTGAAACATGATTAAACTCCTAA
  67>HWI-EAS91_1_306UPAAXX:6:1:1629:908
  68GATGCGGTTATCCATCTGCTTATGGAAGCCAAGCAT
  69>HWI-EAS91_1_306UPAAXX:6:1:1560:849
  70GCTGTCGCTACTTCCCAAGAAGCTGTTCAGAATCAG
  71>HWI-EAS91_1_306UPAAXX:6:1:1029:783
  72GAGAAGTTAATGGATGAATTGGCACAATGCTACAAT
  73>HWI-EAS91_1_306UPAAXX:6:1:1152:1324
  74GACAATCAGAAAGAGATTGCCGAGATGCAAAATGAG
  75>HWI-EAS91_1_306UPAAXX:6:1:1614:2042
  76GAAATGCCACAAGCCTCAATAGCAGGTTTAAGAGCC
  77>HWI-EAS91_1_306UPAAXX:6:1:1398:439
  78GATGGTTGGTTTATCGTTTTTGACACTCTCACGTTG
  79>HWI-EAS91_1_306UPAAXX:6:1:955:616
  80GACTAAAGAGATTCAGTACCTTAACGCTAAAGGTGC
  81>HWI-EAS91_1_306UPAAXX:6:1:1672:753
  82GAATGCCAGCAATCTCTTTTTGAGTCTCATTTTGCT
  83>HWI-EAS91_1_306UPAAXX:6:1:1195:1293
  84GCAATGCGACAGGCTCATGCTGATGGTTGGTTTATC
  85>HWI-EAS91_1_306UPAAXX:6:1:1074:755
  86GCAAGAGTAAACATAGTGCCATGCTCAGGAACAAAG
  87>HWI-EAS91_1_306UPAAXX:6:1:984:499
  88GACTTAGTTCATCAGCAAACGCAGAATCAGCGGTAT
  89>HWI-EAS91_1_306UPAAXX:6:1:1452:1833
  90GCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGGT
  91>HWI-EAS91_1_306UPAAXX:6:1:863:710
  92GAGTTCGATAATGGTGATATGTATGTTGACGGCCAT
  93>HWI-EAS91_1_306UPAAXX:6:1:885:649
  94GCAGAAGTTAACACTTTCGGATATTTCTGATGAGTC
  95>HWI-EAS91_1_306UPAAXX:6:1:917:1214
  96GACAGATGTATCCATCTGAATGCAATGAAGAAAACC
  97>HWI-EAS91_1_306UPAAXX:6:1:892:1254
  98GCTCAGGAAATGCAGCAGCAAGATAATCACGAGTAT
  99>HWI-EAS91_1_306UPAAXX:6:1:1555:1005
 100GCATTTGGCGCATAATCTCGGAAACCTGCTGTTGCT
 101>HWI-EAS91_1_306UPAAXX:6:1:1637:1413
 102GATGCTGTTCAACCACTAATAGGTAAGAAATCATGT
 103>HWI-EAS91_1_306UPAAXX:6:1:1102:1567
 104GGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAA
 105>HWI-EAS91_1_306UPAAXX:6:1:799:1337
 106GTATATGCACAAAATGAGATGCTTGCTTATCAACAG
 107>HWI-EAS91_1_306UPAAXX:6:1:1353:1843
 108GCAGACCCATAATGTCAATAGATGTGGTAGAAGTCG
 109>HWI-EAS91_1_306UPAAXX:6:1:1196:789
 110GCGGCATACGCTCGGCGCCAGTTTGAATATTAGACA
 111>HWI-EAS91_1_306UPAAXX:6:1:1056:1676
 112GTAAAATACTGACCAGCCGTTTGAGCTTGAGTAAGC
 113>HWI-EAS91_1_306UPAAXX:6:1:1349:1836
 114GGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTC
 115>HWI-EAS91_1_306UPAAXX:6:1:1027:788
 116GGTGTTAATGCCACTCCTCTCCCGACTGTTAACACT
 117>HWI-EAS91_1_306UPAAXX:6:1:990:1283
 118GCTTAGGGATTTTATTGGTATCAGGGTTAATCGTGC
 119>HWI-EAS91_1_306UPAAXX:6:1:904:939
 120GAGAAGTTAATGGATGAATTGGCACAATGCTACAAT
 121>HWI-EAS91_1_306UPAAXX:6:1:1732:793
 122GTCAACATACATATCACCATTATCGAACTCAACGCC
 123>HWI-EAS91_1_306UPAAXX:6:1:1355:2003
 124GTTAGACCAAACCATGAAACCAACATAAACATTATT
 125>HWI-EAS91_1_306UPAAXX:6:1:1337:977
 126GCACCAGAAACAAAACTAGGGGCGGCCTCATCAGGG
 127>HWI-EAS91_1_306UPAAXX:6:1:1605:1175
 128GGAGGTAAAACCTCTTATGACGCTGACAACCGTCCT
 129>HWI-EAS91_1_306UPAAXX:6:1:1763:1192
 130GACAGGCCGTTTGAATGTTGACGGGATGAACATAAT
 131>HWI-EAS91_1_306UPAAXX:6:1:722:483
 132GTTATTATACCGTCAAGGACTGTGTGACTATTGACT
 133>HWI-EAS91_1_306UPAAXX:6:1:1760:1136
 134GCAAAGCATTGGGATTATCATAAAACGCCTCTAATC
 135>HWI-EAS91_1_306UPAAXX:6:1:1088:798
 136GGAAACCTGCTGTTGCTTGGAAAGATTGGTGTTTTC
 137>HWI-EAS91_1_306UPAAXX:6:1:633:1076
 138GCTACTTCCCAAGAAGCTGTTCAGAATCAGAATGAG
 139>HWI-EAS91_1_306UPAAXX:6:1:673:754
 140GTCATGGAAGCGATAAAACTCTGCAGGTTGGATATT
 141>HWI-EAS91_1_306UPAAXX:6:1:1759:2019
 142GTAAAGGACGGTTGTCAGCGTCATAAGAGGTTTTAC
 143>HWI-EAS91_1_306UPAAXX:6:1:1064:1797
 144GCGGTTATCCATCTGCTTATGGAAGCCAAGCATTGG
 145>HWI-EAS91_1_306UPAAXX:6:1:1112:1669
 146GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACT
 147>HWI-EAS91_1_306UPAAXX:6:1:510:1447
 148GCATTAAGCTCAGGAAATGCAGCAGCAAGATAATCA
 149>HWI-EAS91_1_306UPAAXX:6:1:877:1573
 150GTGCTATTGCTGGCGGTATTTCTTCTTCTTTTTTTT
 151>HWI-EAS91_1_306UPAAXX:6:1:870:542
 152GAATGTCACGCTGATTATTTTGACTTTGAGCGTATC
 153>HWI-EAS91_1_306UPAAXX:6:1:966:384
 154GCACCTGTTTTACAGACACCTAAAGCTACATCGTCA
 155>HWI-EAS91_1_306UPAAXX:6:1:1186:1903
 156GCCAGCGATAACCGGAGTAGTTGAAATGGTAATAAG
 157>HWI-EAS91_1_306UPAAXX:6:1:1632:1742
 158GCATCACCCATGCCTACAGTATTGTTATCGGTAGCC
 159>HWI-EAS91_1_306UPAAXX:6:1:1521:559
 160GAGAGCGCCAACGGCGTCCATCTCGAAGGAGTCGCC
 161>HWI-EAS91_1_306UPAAXX:6:1:683:454
 162GCTTATTATGTTCATCCCGTCAACATTCAAACGTCC
 163>HWI-EAS91_1_306UPAAXX:6:1:112:1280
 164GTTGGCGCTCTCCGTCTTTCTCCATTTCGTCGTGTC
 165>HWI-EAS91_1_306UPAAXX:6:1:891:381
 166GACCAGGGCGAGCGCCAGAACGTTTTTTACCTTTAG
 167>HWI-EAS91_1_306UPAAXX:6:1:1348:958
 168GATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTT
 169>HWI-EAS91_1_306UPAAXX:6:1:1785:1915
 170GCCCCGAAGGGGACNANAAATGGTTTTTAGAGAACG
 171>HWI-EAS91_1_306UPAAXX:6:1:1418:42
 172GTATGCCCATCGCAGTTCGCTACACGCAGGACGCTT
 173>HWI-EAS91_1_306UPAAXX:6:1:1421:743
 174GGTCAACGCTACCTGTAGGAAGTGTCCGCATAAAAT
 175>HWI-EAS91_1_306UPAAXX:6:1:1079:790
 176GCCAAATGCTTACTCAAGCTCAAACGGCTGGTCAGT
 177>HWI-EAS91_1_306UPAAXX:6:1:663:740
 178GGTATTAAGGATGAGTGTTCAAGATTGCTGGATGCC
 179>HWI-EAS91_1_306UPAAXX:6:1:1245:413
 180GTTTGAATGTTGACGGGATGAACATAATAAGCAATG
 181>HWI-EAS91_1_306UPAAXX:6:1:1378:1035
 182GCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGG
 183>HWI-EAS91_1_306UPAAXX:6:1:903:1746
 184GTACGGGGAAGGACGTCAATAGTCACACAGTCCTTG
 185>HWI-EAS91_1_306UPAAXX:6:1:1713:1134
 186GGCGTACGGGGAAGGACGTCAATAGTCACACAGTCC
 187>HWI-EAS91_1_306UPAAXX:6:1:1246:1887
 188GCTCTAATCTCTGGGCATCTGGCTATGATGTTGATG
 189>HWI-EAS91_1_306UPAAXX:6:1:872:1731
 190GGGCGGCCTCATCAGGGTTAGGAACATTAGAGCCTT
 191>HWI-EAS91_1_306UPAAXX:6:1:1714:1582
 192GCTTTCCTGCTCCTGTTGAGTTTATTGCTTCCGTCT
 193>HWI-EAS91_1_306UPAAXX:6:1:1785:763
 194GNCGAGAAATAAAANNNTGAAACATGATTAAANTCC
 195>HWI-EAS91_1_306UPAAXX:6:1:1684:542
 196GAAAAGACAGAATCTCTTCCAAGAGCTTGATGCGGT
 197>HWI-EAS91_1_306UPAAXX:6:1:1581:1665
 198GACTTTGAGCGTATCGAGGCTCTTAAACCTGCTATT
 199>HWI-EAS91_1_306UPAAXX:6:1:901:1581
 200GTGCTGATATTGCTTTTGATGCCGACCCTAAATTTT
 201>HWI-EAS91_1_306UPAAXX:6:1:1128:239
 202GGTTATTATACCGTCAAGGACTGTGTGACTATTGAC
 203>HWI-EAS91_1_306UPAAXX:6:1:969:441
 204GGTAAGAAATCATGAGTCAAGTTACTGAACAATCCG
 205>HWI-EAS91_1_306UPAAXX:6:1:630:1087
 206GCCACCATGATTATGACCAGTGTTTCCAGTCCGTTC
 207>HWI-EAS91_1_306UPAAXX:6:1:606:1852
 208GGAGACAAATAATCTCTTTAATAACCTGATTCAGCG
 209>HWI-EAS91_1_306UPAAXX:6:1:489:1315
 210GAAAGCTCAGTCTCAGGAGGAAGCGGAGCAGTCCAC
 211>HWI-EAS91_1_306UPAAXX:6:1:465:1983
 212GAGCCAATACCATCAGCTTTACCGTCTTTCCAGAAA
 213>HWI-EAS91_1_306UPAAXX:6:1:559:1028
 214GAGTGCTTAATCCAACTTACCAAGCTGGGTTACGAC
 215>HWI-EAS91_1_306UPAAXX:6:1:1655:1413
 216GTATGTTGACGGCCATAAGGCTGCTTCTGACGTTCG
 217>HWI-EAS91_1_306UPAAXX:6:1:980:605
 218GCCGTTTGAATGTTGACGGGATGAACATAATAAGCA
 219>HWI-EAS91_1_306UPAAXX:6:1:1629:1865
 220GAAAAGCGGCATGGTCAATATAACCAGTAGTGTTAT
 221>HWI-EAS91_1_306UPAAXX:6:1:1180:1920
 222GCACTCCGTGGACAGATTTGTCATTGTGAGCATTTT
 223>HWI-EAS91_1_306UPAAXX:6:1:1116:383
 224GCGCAGGAAACACTGACGTTCTTACTGACGCAGAAG
 225>HWI-EAS91_1_306UPAAXX:6:1:906:2041
 226GTCACGTTTATGGTGAACAGTGGATTAAGTTCATGA
 227>HWI-EAS91_1_306UPAAXX:6:1:1514:157
 228GTCAATAGATGTGGTAGAAGTCGTCATTTGGCGTGG
 229>HWI-EAS91_1_306UPAAXX:6:1:1032:1857
 230GCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGT
 231>HWI-EAS91_1_306UPAAXX:6:1:638:609
 232GATTCTGTCAAAAACTGACGCGTTGGATGAGGAGAT
 233>HWI-EAS91_1_306UPAAXX:6:1:74:750
 234GATAATCACGAGTATCCTTTCCTTTATCATCTTCAT
 235>HWI-EAS91_1_306UPAAXX:6:1:486:822
 236GTTGACGATGTAGCTTTAGGTGTCTTTAAAACAGGT
 237>HWI-EAS91_1_306UPAAXX:6:1:899:473
 238GAACAGCATCGGACTCAGATAGTAATCCACGCTCTT
 239>HWI-EAS91_1_306UPAAXX:6:1:1613:197
 240GTGACATTCAGAAGGGTAATAAGAACGAACCATAAA
 241>HWI-EAS91_1_306UPAAXX:6:1:326:1747
 242GTTGAGGCTTTCGTTTATTGTACGCTTTGCTTTTTT
 243>HWI-EAS91_1_306UPAAXX:6:1:1487:526
 244GCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
 245>HWI-EAS91_1_306UPAAXX:6:1:629:665
 246GAAATGCAGCAGCAAGATAATCACGAGTATCCTTTC
 247>HWI-EAS91_1_306UPAAXX:6:1:766:744
 248GGCCGTCAACATACATATCACCATTATCGAACTCAA
 249>HWI-EAS91_1_306UPAAXX:6:1:391:1771
 250GTGGTTGATATTTTTCATGGTATTGATAAATCTTTT
 251>HWI-EAS91_1_306UPAAXX:6:1:591:1102
 252GCTTTGCGTGACTATTTTCGTGATATTGTTCGTTTG
 253>HWI-EAS91_1_306UPAAXX:6:1:917:664
 254GCCATGATGGTGGTTATTATACCGTCAAGGACTGTG
 255>HWI-EAS91_1_306UPAAXX:6:1:217:737
 256GTTCAGTTGTTGCATTGGAATATTCAGTTTAAATTT
 257>HWI-EAS91_1_306UPAAXX:6:1:1047:839
 258GACCATTCAAAGGATAAACATCATAGGCAGTCGGGG
 259>HWI-EAS91_1_306UPAAXX:6:1:558:1040
 260GCCACCAGCAAGAGCAGAAGCAATACCGCCAGCAAT
 261>HWI-EAS91_1_306UPAAXX:6:1:1207:524
 262GCCAATACCATCAGCTTTACCGTCTTTCCAGAAATT
 263>HWI-EAS91_1_306UPAAXX:6:1:708:1634
 264GCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAG
 265>HWI-EAS91_1_306UPAAXX:6:1:576:1851
 266GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAG
 267>HWI-EAS91_1_306UPAAXX:6:1:906:460
 268GTAGACATTTTTACTTTTTATGTCCCTCATCGTCAC
 269>HWI-EAS91_1_306UPAAXX:6:1:693:1260
 270GCGAAAGGTCGCAAAGTAAGAGCTTCTCGAGCTGCG
 271>HWI-EAS91_1_306UPAAXX:6:1:1373:286
 272GGACACTTCCTACAGGTAGCGTTGACCCTAATTTTG
 273>HWI-EAS91_1_306UPAAXX:6:1:762:41
 274GATACTTGGAACAATTTCTGGAAAGACGGTAAAGCT
 275>HWI-EAS91_1_306UPAAXX:6:1:475:1091
 276GTCACACAGTCCTTGACGGTATAATAACCACCATCT
 277>HWI-EAS91_1_306UPAAXX:6:1:791:627
 278GCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACC
 279>HWI-EAS91_1_306UPAAXX:6:1:336:1791
 280GAAGGAGTCGCCAGCGATAACCGGAGTAGTTGAAAT
 281>HWI-EAS91_1_306UPAAXX:6:1:1483:943
 282GCACGTAATTTTTGACGCACGTTTTCTTCTGCGTCT
 283>HWI-EAS91_1_306UPAAXX:6:1:641:1071
 284GATGGGCATACTGTAACCATAAGGCCACGTATTTTG
 285>HWI-EAS91_1_306UPAAXX:6:1:196:755
 286GAACGCCCTCTTAAGGATATTCGCGATGAGTATAAT
 287>HWI-EAS91_1_306UPAAXX:6:1:463:1398
 288GTCATAAGAGGTTTTACCTCCAAATGAAGAAATAAC
 289>HWI-EAS91_1_306UPAAXX:6:1:1559:460
 290GCTCACAATGACAAATCTGTCCACGGAGTGCTTAAT
 291>HWI-EAS91_1_306UPAAXX:6:1:1625:1561
 292GAGGAGTGGCATTAACACCATCCTTCATGAACTTAC
 293>HWI-EAS91_1_306UPAAXX:6:1:1729:1588
 294GCTGATAAAGGAAAGGATACTCGTGATTATCTTGCT
 295>HWI-EAS91_1_306UPAAXX:6:1:945:393
 296GGCCTCATCAGGGTTAGGAACATTAGAGCCTTGAAT
 297>HWI-EAS91_1_306UPAAXX:6:1:298:1391
 298GTAAAGTTAGACCAAACCATGAAACCAACATAAACA
 299>HWI-EAS91_1_306UPAAXX:6:1:1270:1500
 300GAATTACTACTGCTTGTTTACGAATTAAATATATGT
 301>HWI-EAS91_1_306UPAAXX:6:1:481:1546
 302GCTGGCATTCAGTCGGCGACTTCACGCCAGAATACG
 303>HWI-EAS91_1_306UPAAXX:6:1:473:1729
 304GTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAT
 305>HWI-EAS91_1_306UPAAXX:6:1:801:1831
 306GCTGAGGTTGACTTAGTTCATCAGCAAACGCAGAAT
 307>HWI-EAS91_1_306UPAAXX:6:1:536:639
 308GCCGACCCTAAATTTTTTGCCTGTTTGGTTCTCTTT
 309>HWI-EAS91_1_306UPAAXX:6:1:259:938
 310GTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTG
 311>HWI-EAS91_1_306UPAAXX:6:1:907:1513
 312GGCATGGGTGATGCTGGTATTAAATCTGCCATTCAC
 313>HWI-EAS91_1_306UPAAXX:6:1:372:1409
 314GATGAGTATAATTACCCCAAAAAGAAAGGTATTAAG
 315>HWI-EAS91_1_306UPAAXX:6:1:485:1626
 316GATGGCAGCAACGGAAACCATAACGAGCATCATCTT
 317>HWI-EAS91_1_306UPAAXX:6:1:583:1679
 318GCTCAAAGTCAAAATAATCAGCGTGACATTCAGAAG
 319>HWI-EAS91_1_306UPAAXX:6:1:690:1610
 320GACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTT
 321>HWI-EAS91_1_306UPAAXX:6:1:257:918
 322GCAGGCTGGCACTTCTGCCGTTTCTGATAAGTTTCT
 323>HWI-EAS91_1_306UPAAXX:6:1:818:33
 324GTGTTAATGCCACTCCTCTCCCGACTGTTAACTCTG
 325>HWI-EAS91_1_306UPAAXX:6:1:541:1242
 326GGGATTATCATAAAACGCCTCTAATCGGTCGTCAGC
 327>HWI-EAS91_1_306UPAAXX:6:1:1014:279
 328GTAAAAATGTCTACAGTAGAGTCAATAGCAAGGCCC
 329>HWI-EAS91_1_306UPAAXX:6:1:672:1790
 330GGCCGTTTGAATGTTGACGGGATGAACATAATAAGC
 331>HWI-EAS91_1_306UPAAXX:6:1:708:464
 332GGAGACAAATAATCTCTTTAATAACCTGATTCAGCG
 333>HWI-EAS91_1_306UPAAXX:6:1:633:1486
 334GGGAAAGGTCATGCGGCATACGCTCGGCGCCAGTTT
 335>HWI-EAS91_1_306UPAAXX:6:1:328:696
 336GTTCCGACTACCCTCCCGACTGCCTATGATGTTTAT
 337>HWI-EAS91_1_306UPAAXX:6:1:259:1389
 338GCGTACTTATTCGCCACCATGATTATTACCAGTGTT
 339>HWI-EAS91_1_306UPAAXX:6:1:1315:41
 340GCTTTCCGTGATGTCACAGCCTGCTTTGATGTGTCG
 341>HWI-EAS91_1_306UPAAXX:6:1:1647:549
 342GCTTAATCCAACTTACCAAGCTGGGTTACGACGCGC
 343>HWI-EAS91_1_306UPAAXX:6:1:300:886
 344GTTCTTGGTCAGTATGCAAATTAGCATAAGCAGCTT
 345>HWI-EAS91_1_306UPAAXX:6:1:317:1411
 346GTACGCTGTACTTTGTGGGATACCCTCGCTTTCCTT
 347>HWI-EAS91_1_306UPAAXX:6:1:321:1819
 348GGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGT
 349>HWI-EAS91_1_306UPAAXX:6:1:631:70
 350GTGGATTACTATCTGAGTCCGATGCTGTTCAACCAC
 351>HWI-EAS91_1_306UPAAXX:6:1:624:1040
 352GCTGGCGACTCCTTCGAGATGGACGCCGTTTGCGCT
 353>HWI-EAS91_1_306UPAAXX:6:1:662:1187
 354GGGAGAGGAGTGGCATTAACACCATCCTTCATGACC
 355>HWI-EAS91_1_306UPAAXX:6:1:1440:1959
 356GAATCAGCGGTATGGCTCCTCTCCTATTTTTGCTTC
 357>HWI-EAS91_1_306UPAAXX:6:1:458:1629
 358GCTGGTGGCGCCATGTCTAAATTTTTTGGAGGCGGT
 359>HWI-EAS91_1_306UPAAXX:6:1:216:790
 360GGGATGAAAATGCTCACAATGACAAATCTGTCCACG
 361>HWI-EAS91_1_306UPAAXX:6:1:1407:1174
 362TTACCTATTAGTGGTTGAACAGCATCGGACTCAGAT
 363>HWI-EAS91_1_306UPAAXX:6:1:999:1790
 364GTCCTGCGTGTAGCGAACTGCGATGGGCATACTGTC
 365>HWI-EAS91_1_306UPAAXX:6:1:141:1994
 366GGCTTTTTTATGGTTCGTTCTTATTACCCTTCTTAT
 367>HWI-EAS91_1_306UPAAXX:6:1:225:465
 368GTCAGATATGGACCTTGCTGCTAAAGGTCTAGGAGC
 369>HWI-EAS91_1_306UPAAXX:6:1:649:1760
 370GACCCATAATGTCAATAGATGTGGTAGAAGTCGTCT
 371>HWI-EAS91_1_306UPAAXX:6:1:300:986
 372GTTGAACACGACCAGAAAACTGGCCTAACGACGTTT
 373>HWI-EAS91_1_306UPAAXX:6:1:478:605
 374GAGACTGAGCTTTCTCGCCAAATGACGACTTCTACC
 375>HWI-EAS91_1_306UPAAXX:6:1:622:395
 376GGTAGCTTTAAGCGGCTCACCTTTAGCATCAACAGG
 377>HWI-EAS91_1_306UPAAXX:6:1:1701:574
 378GTAAAGCCTCTACGCGATTTCATAGTGGAGGCCTCC
 379>HWI-EAS91_1_306UPAAXX:6:1:646:59
 380GGAAGTGTCCGCATAAAATGCACCGCATGGAAATGT
 381>HWI-EAS91_1_306UPAAXX:6:1:284:2031
 382GACAGAATCGTTAGTTGATGGCGAAAGGTCGCAAAG
 383>HWI-EAS91_1_306UPAAXX:6:1:22:1009
 384GATGGATACATCTGTCAACGCCGCTAATCAGGTTGT
 385>HWI-EAS91_1_306UPAAXX:6:1:47:1826
 386GCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCG
 387>HWI-EAS91_1_306UPAAXX:6:1:1025:1236
 388TGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGT
 389>HWI-EAS91_1_306UPAAXX:6:1:773:591
 390GAGCAGGAAAGCGAGGGTATCCCACAAAGTCCAGCG
 391>HWI-EAS91_1_306UPAAXX:6:1:1753:527
 392GGTGGCATTCAAGGTGATGTGCTTGCTACCGATAAC
 393>HWI-EAS91_1_306UPAAXX:6:1:426:1717
 394GTAGCGCCAATATGAGAAGAGCCATACCGCTGATTC
 395>HWI-EAS91_1_306UPAAXX:6:1:959:818
 396TTCTGATAAGCTGGTTCTCACTTCTGTTACTCCAGC
 397>HWI-EAS91_1_306UPAAXX:6:1:459:1344
 398GCCTATGATGTTTATCCTTTGAATGGTCGCCATGAT
 399>HWI-EAS91_1_306UPAAXX:6:1:973:1367
 400TTCGTGATGAGTTTGTATCTGTTACTGATAAGTTAT
 401>HWI-EAS91_1_306UPAAXX:6:1:201:871
 402GATTAGAGGCGTTTTATGATAATCCCAATGCTTTTC
 403>HWI-EAS91_1_306UPAAXX:6:1:713:1672
 404GGCGTACGGGGAAGGACGTCAATAGTCACACAGTCC
 405>HWI-EAS91_1_306UPAAXX:6:1:444:1435
 406TTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGTG
 407>HWI-EAS91_1_306UPAAXX:6:1:288:1136
 408GCCTTCCATGATGAGACAGGCCGTTTTAATTTTTTC
 409>HWI-EAS91_1_306UPAAXX:6:1:1653:225
 410GCAAGGCCACGACGCAATGGAGAAAGACGGAGAGCG
 411>HWI-EAS91_1_306UPAAXX:6:1:537:1764
 412GCTCCGCTTCCTCCTGAGACTGAGCTTTCTCGCCAA
 413>HWI-EAS91_1_306UPAAXX:6:1:196:1854
 414GTATCGAGGCTCTTAAACCTGCTATTTAGGCTTTTT
 415>HWI-EAS91_1_306UPAAXX:6:1:312:1707
 416GCGTCATAAGAGGTTTTACCTCCAAATGAAGAAATA
 417>HWI-EAS91_1_306UPAAXX:6:1:651:183
 418GTATGTTTCTCCTGCTTATCACCTTCTTGAAGGCTT
 419>HWI-EAS91_1_306UPAAXX:6:1:295:694
 420GTGATTACTTCATGCAGCGTTACCGTGATGTTATTT
 421>HWI-EAS91_1_306UPAAXX:6:1:330:1895
 422GCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTG
 423>HWI-EAS91_1_306UPAAXX:6:1:590:331
 424GAAATTTCTATGAATGATGTTTTCCGTTCTGGTGAT
 425>HWI-EAS91_1_306UPAAXX:6:1:481:1687
 426GCAGATTGCGATAAACGGTCACATTAAATTTAACCT
 427>HWI-EAS91_1_306UPAAXX:6:1:1112:1279
 428TGTGCATATACCTGGTCTTTCGTATTCTGTCGTGAT
 429>HWI-EAS91_1_306UPAAXX:6:1:1099:1216
 430TTAGAGCGCATGACAAGTAAAGGACGGTTGTCAGCG
 431>HWI-EAS91_1_306UPAAXX:6:1:221:1238
 432GTATCCTTTCCTTTATCATCGGCAGACTTTTCACCT
 433>HWI-EAS91_1_306UPAAXX:6:1:1015:364
 434GCCAGCGATAACCGGAGTAGTTGAAATGGTAATAAG
 435>HWI-EAS91_1_306UPAAXX:6:1:735:1806
 436TGTTATTAATATCAAGTTGGGGGAGCACATTGTAGC
 437>HWI-EAS91_1_306UPAAXX:6:1:320:411
 438GCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGTG
 439>HWI-EAS91_1_306UPAAXX:6:1:1273:1031
 440TTAAGGATATTCGCGATGAGTATAATTACCCCAAAA
 441>HWI-EAS91_1_306UPAAXX:6:1:1456:1088
 442AATAATCAGCGTGACATTCAGAAGGGTAATAAGAAC
 443>HWI-EAS91_1_306UPAAXX:6:1:1365:307
 444GACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAG
 445>HWI-EAS91_1_306UPAAXX:6:1:478:252
 446GATGCGGTTATCCATCTGCTTATTGAAGCCAAGCAT
 447>HWI-EAS91_1_306UPAAXX:6:1:915:1232
 448TATTAATAACACTATAGACCACCGCCCCGAAGGGGC
 449>HWI-EAS91_1_306UPAAXX:6:1:680:1357
 450TTCCTCCTGAGACTGAGCTTTCTCGCCAAATGACGC
 451>HWI-EAS91_1_306UPAAXX:6:1:238:1279
 452GCCGAAGCCCCTGCAATTAAAATTGTTGACCACCTA
 453>HWI-EAS91_1_306UPAAXX:6:1:1583:35
 454GCAAATTAGCATAAGCAGCTTGCAGACCCATAATGT
 455>HWI-EAS91_1_306UPAAXX:6:1:502:283
 456GTTCCGACTACCCTCCCGACTGCCTATGATGTTTAT
 457>HWI-EAS91_1_306UPAAXX:6:1:418:1730
 458GAAGGCTTCCCATTCATTCAGGAACCGCCTTCTGGT
 459>HWI-EAS91_1_306UPAAXX:6:1:596:647
 460GCCTCAACGCAGCGACGAGCACGAGAGCGGTCAGTA
 461>HWI-EAS91_1_306UPAAXX:6:1:92:1591
 462GTTCATGAAGGATGGTGTTAATGCCACTCCTCTCCC
 463>HWI-EAS91_1_306UPAAXX:6:1:430:1938
 464GCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGTCC
 465>HWI-EAS91_1_306UPAAXX:6:1:212:527
 466GGTATTGATAAAGCTGTTGCCGATACTTGTAACAAT
 467>HWI-EAS91_1_306UPAAXX:6:1:594:942
 468GACGACATTAGAAATATCCTTTGCAGTAGCGCCAAT
 469>HWI-EAS91_1_306UPAAXX:6:1:169:1774
 470GCCTTCCATGATGAGACAGGCCGTTTTAATTTTTAC
 471>HWI-EAS91_1_306UPAAXX:6:1:1090:210
 472GGAGAGCGCCAACGGCGTCCATCTCGAAGGAGTCGC
 473>HWI-EAS91_1_306UPAAXX:6:1:589:96
 474GGCGGCCCCATCAGGGTTAGGAACATTAGAGCCTTG
 475>HWI-EAS91_1_306UPAAXX:6:1:1477:1231
 476TAGGAACATTAGAGCCTTGAATGGCAGATTTAATAC
 477>HWI-EAS91_1_306UPAAXX:6:1:707:1076
 478TCTGACGTTCGTGATGAGTTTGTATCTTTTTCTTTG
 479>HWI-EAS91_1_306UPAAXX:6:1:749:1715
 480GAACATAATAAGCAATGACGGCAGCAATAAACTCAA
 481>HWI-EAS91_1_306UPAAXX:6:1:1738:1884
 482GCTCACCTTTAGCATCAACAGGCCACAACCAACCAG
 483>HWI-EAS91_1_306UPAAXX:6:1:1160:1088
 484TCACATTTTGTTCATGGTAGAGATTCTCTTGTTGAC
 485>HWI-EAS91_1_306UPAAXX:6:1:517:119
 486GCAAGGCTAATGATTCACACGCCGACTGCTATCAGT
 487>HWI-EAS91_1_306UPAAXX:6:1:1472:716
 488TGGTAATGGTGGTTTTCTTCATTTCATTCAGTTTTT
 489>HWI-EAS91_1_306UPAAXX:6:1:281:441
 490GAGCAGTAGACTCCTTCTGTTGATAAGCAAGCATCT
 491>HWI-EAS91_1_306UPAAXX:6:1:1101:324
 492AATACCATCAGCTTTACCGTCTTTCCAGAAATTGTT
 493>HWI-EAS91_1_306UPAAXX:6:1:1225:1494
 494TTCTCAAATCCGGCGTCAACCATACCAGCAGAGGAA
 495>HWI-EAS91_1_306UPAAXX:6:1:1509:1025
 496TTCTTGCTGCCGAGGGTCGCAAGGCTATTGTTTCAC
 497>HWI-EAS91_1_306UPAAXX:6:1:592:510
 498GATACCAATAAAATCCCTAAGCATTTGTTTCTGGTT
 499>HWI-EAS91_1_306UPAAXX:6:1:324:1729
 500GAACAAAGAAACGCGGCACAGAATGTTTATAGGTCT
 501>HWI-EAS91_1_306UPAAXX:6:1:128:1925
 502GGAACAACTCACTAAAAACCAAGCTGTCGCTACTTC
 503>HWI-EAS91_1_306UPAAXX:6:1:786:893
 504TACGGGGAAGGACGTCAATAGTCACACAGTCCTTGC
 505>HWI-EAS91_1_306UPAAXX:6:1:248:955
 506GCTACAATGTGCTCCCCCAACTTGATATTAATAACA
 507>HWI-EAS91_1_306UPAAXX:6:1:388:1127
 508GATATTGGTCGTATGGTTCTTGCTGCCTAGTGTCTC
 509>HWI-EAS91_1_306UPAAXX:6:1:721:1156
 510TCTGGTTGGTTGTGGCCTTTTTATGCTAAATGTTAG
 511>HWI-EAS91_1_306UPAAXX:6:1:1564:1468
 512TTACTTTTTATGTCCCTCATCGTCACGTTTATGTTG
 513>HWI-EAS91_1_306UPAAXX:6:1:750:77
 514GGCTCATTCTGATTCTGAACAGCTTCTTGGGAAGTA
 515>HWI-EAS91_1_306UPAAXX:6:1:405:487
 516GTTGGATTAAGCACTCCGTGGACAGATTTGTCATTT
 517>HWI-EAS91_1_306UPAAXX:6:1:836:1204
 518TTGCTTCTGCTCTTGCTTGTGGCGCCATGTCTAAAT
 519>HWI-EAS91_1_306UPAAXX:6:1:224:1548
 520GCTGCCGTCATTGCTTATTATGTTCATCCCTTCAAC
 521>HWI-EAS91_1_306UPAAXX:6:1:931:1015
 522TTAAGGTACTGAATCTCTTTAGTCGCAGTAGGCGGT
 523>HWI-EAS91_1_306UPAAXX:6:1:329:579
 524GTCCCTCATCGTCACGTTTATGGTGAACAGTGGATT
 525>HWI-EAS91_1_306UPAAXX:6:1:260:1145
 526GCTTGCGTTTATGGTACGCTGGACTTTTTGTGATAC
 527>HWI-EAS91_1_306UPAAXX:6:1:1523:1253
 528TTGGTAAAATACTGACCAGCCGTTTGAGCTTGAGTA
 529>HWI-EAS91_1_306UPAAXX:6:1:326:1271
 530GACCACTCGCGATTCAATCATGACTTCGTGATAAAT
 531>HWI-EAS91_1_306UPAAXX:6:1:213:622
 532GCACCTGTTTTACAGACACCTAAAGCTACATCGTCA
 533>HWI-EAS91_1_306UPAAXX:6:1:274:712
 534GCGGTCAAAAAGCCGCCTCCGGTGGCATTCAAGGTG
 535>HWI-EAS91_1_306UPAAXX:6:1:1549:627
 536TATGGTTCTTGCTGCCGAGGGTCGCAAGGCTAATGT
 537>HWI-EAS91_1_306UPAAXX:6:1:1714:737
 538TCTTTCGTATTCTGGCGTGAAGTCGCCGACTGAATG
 539>HWI-EAS91_1_306UPAAXX:6:1:760:1217
 540TACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTT
 541>HWI-EAS91_1_306UPAAXX:6:1:174:768
 542GTTGGCTGACGACCGATTAGAGGCGTTTTTTTATAT
 543>HWI-EAS91_1_306UPAAXX:6:1:172:1412
 544GGTCGGCAGATTGCGATAAACGTTCACATTAAATTT
 545>HWI-EAS91_1_306UPAAXX:6:1:1393:869
 546TTCATCCCGTCAACATTCAAACGGCCTGTCTCATCT
 547>HWI-EAS91_1_306UPAAXX:6:1:301:481
 548GTTATAGATATTCAAATAACCCTGAAACAAATGCTT
 549>HWI-EAS91_1_306UPAAXX:6:1:648:1093
 550TAACGCTGCATGAAGTAATCACGTTCTTGGTCAGTT
 551>HWI-EAS91_1_306UPAAXX:6:1:1233:591
 552TTCCCATCTTGGCTTCCTTGCTGGTCAGATTGGTCT
 553>HWI-EAS91_1_306UPAAXX:6:1:540:1415
 554TTATTAAAGAGATTATTTTTCTCCAGCCACTTATGT
 555>HWI-EAS91_1_306UPAAXX:6:1:151:1792
 556GCAAGCTGCTTATGCTAATTTGCATACTGACCAAGA
 557>HWI-EAS91_1_306UPAAXX:6:1:748:1378
 558TGGATTACTATCTGAGTCCGATGCTGTTCAACCACT
 559>HWI-EAS91_1_306UPAAXX:6:1:1526:1479
 560TGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAGCC
 561>HWI-EAS91_1_306UPAAXX:6:1:985:1093
 562TAACCGTCTTCTCGTTCTCTAAAAACCATTTTTCTT
 563>HWI-EAS91_1_306UPAAXX:6:1:480:1378
 564TCAACCTCAGCACTAACCTTGCGAGTCATTTCTTTG
 565>HWI-EAS91_1_306UPAAXX:6:1:903:753
 566TGTGGCCTGTTGATGCTAAAGGTGAGCCGCTTAAAG
 567>HWI-EAS91_1_306UPAAXX:6:1:1697:1737
 568GGCGACCCTGTTTTGTATGGCAACTTGCCGCCGCGT
 569>HWI-EAS91_1_306UPAAXX:6:1:803:1037
 570TGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCTACT
 571>HWI-EAS91_1_306UPAAXX:6:1:1727:1244
 572TTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCT
 573>HWI-EAS91_1_306UPAAXX:6:1:253:1162
 574GCATTTAGTAGCGGTAAAGTTTGACCAAACCATTAT
 575>HWI-EAS91_1_306UPAAXX:6:1:216:856
 576GTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCT
 577>HWI-EAS91_1_306UPAAXX:6:1:825:886
 578TCCCACAAAGTCCAGCGTACCATAAACGCAAGCCTC
 579>HWI-EAS91_1_306UPAAXX:6:1:1699:962
 580TGATTTCGATTTTCTGACGAGTAACAAAGTTTGGAT
 581>HWI-EAS91_1_306UPAAXX:6:1:1210:625
 582TCAGATAGTAATCCACGCTCTTTTAAAATGTCAACA
 583>HWI-EAS91_1_306UPAAXX:6:1:538:616
 584TAAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGT
 585>HWI-EAS91_1_306UPAAXX:6:1:184:1849
 586GCTCACCTTTAGCATCAACAGGCCACAACCAACCAG
 587>HWI-EAS91_1_306UPAAXX:6:1:1636:1103
 588TATCTGACTTTTTGTTAACGTATTTAGCCACATAGA
 589>HWI-EAS91_1_306UPAAXX:6:1:605:223
 590GGTTATTTGAATATCTATAACAACTATTTTAAATCG
 591>HWI-EAS91_1_306UPAAXX:6:1:256:1052
 592GGTAAAGGACTTCTTGAAGGTACGTTGCAGTCTGGC
 593>HWI-EAS91_1_306UPAAXX:6:1:300:1515
 594GCCATGATGGTGGTTATTATACCGTCAAGGACTTTT
 595>HWI-EAS91_1_306UPAAXX:6:1:1684:1320
 596TGCTTGGCTTCCATAAGCAGATGGATAACCGCATCA
 597>HWI-EAS91_1_306UPAAXX:6:1:1186:895
 598TCAGATGGATACATCTGTCAACGCCGCTAATCAGGT
 599>HWI-EAS91_1_306UPAAXX:6:1:1463:754
 600TCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTT
 601>HWI-EAS91_1_306UPAAXX:6:1:808:1053
 602TGTCCACGGAGTGCTTAATCCAACTTACCAAGCTGG
 603>HWI-EAS91_1_306UPAAXX:6:1:960:1218
 604TTTCTAATGTCGTCACTGATGCTGCTTCTGTTGTTT
 605>HWI-EAS91_1_306UPAAXX:6:1:521:1646
 606GGAAAACGAACAAGCGCAAGAGTAAACATAGTGCCA
 607>HWI-EAS91_1_306UPAAXX:6:1:289:1885
 608GCCAGCGATAACCGGAGTAGTTGAAATGGTAATAAG
 609>HWI-EAS91_1_306UPAAXX:6:1:471:170
 610GGTCAGTTCCATCAACATCATAGCCAGATGCCCAGA
 611>HWI-EAS91_1_306UPAAXX:6:1:828:754
 612TTTGCGTGACTATTTTCGTGATATTGTTCGTATGGT
 613>HWI-EAS91_1_306UPAAXX:6:1:924:1679
 614TTTAATGTGACCGTTTATCGCAATCTGCCGACCACT
 615>HWI-EAS91_1_306UPAAXX:6:1:837:901
 616TGCATTTTAGTAAGCTCTTTTTGATTCTCAAATCCG
 617>HWI-EAS91_1_306UPAAXX:6:1:543:16
 618GCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTC
 619>HWI-EAS91_1_306UPAAXX:6:1:1482:578
 620TCTTTAGCTCCTAGACCTTTAGCAGCAAGGTCCATA
 621>HWI-EAS91_1_306UPAAXX:6:1:1254:1668
 622TTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCT
 623>HWI-EAS91_1_306UPAAXX:6:1:1402:898
 624TCATGAGTCAAGTTACTGAACAATCCGTACGTTTCC
 625>HWI-EAS91_1_306UPAAXX:6:1:764:1534
 626TTATACCGTCAAGGACTGTGTGACTATTGACGTCCT
 627>HWI-EAS91_1_306UPAAXX:6:1:681:1079
 628TGGCGAATAAGTACGCGTTCTTGCAAATCACCAGAA
 629>HWI-EAS91_1_306UPAAXX:6:1:672:1350
 630TTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTT
 631>HWI-EAS91_1_306UPAAXX:6:1:1266:493
 632TGACCAGCCGTTTGAGCTTGAGTAAGCATTTGGCGC
 633>HWI-EAS91_1_306UPAAXX:6:1:118:238
 634GACGGTATAATAACCACCATCATGGCGACCATTCAA
 635>HWI-EAS91_1_306UPAAXX:6:1:699:433
 636TTATTGCCCGGCGTACGGGGAAGGACGTCAATAGTC
 637>HWI-EAS91_1_306UPAAXX:6:1:708:1387
 638TGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTAC
 639>HWI-EAS91_1_306UPAAXX:6:1:498:1085
 640TTATGATAATCCCAATGCTTTGCGTGACTATTTTCT
 641>HWI-EAS91_1_306UPAAXX:6:1:1101:1301
 642TCCGTACGTTTCCAGACCGCTTTGGCCTCTATTAAT
 643>HWI-EAS91_1_306UPAAXX:6:1:261:213
 644GAATGGTCGCCATGATGGTGGTTATTATACCGTCAC
 645>HWI-EAS91_1_306UPAAXX:6:1:1287:1267
 646TGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGT
 647>HWI-EAS91_1_306UPAAXX:6:1:744:331
 648TTAATGGATGAATTGGCACAATGCTACAATGTGCTC
 649>HWI-EAS91_1_306UPAAXX:6:1:614:814
 650TGTCAGCGTCATAAGAGGTTTTACCTCCAAATGAAG
 651>HWI-EAS91_1_306UPAAXX:6:1:1362:1063
 652TAAACGCAAGCCTCAACGCAGCGACGAGCACGAGAG
 653>HWI-EAS91_1_306UPAAXX:6:1:1238:1508
 654TCAACTAACGATTCTGTCAAAAACTGACGCGTTGGT
 655>HWI-EAS91_1_306UPAAXX:6:1:904:1130
 656TTATCGCAATCTGCCGACCACTCGCGATTCAATCAT
 657>HWI-EAS91_1_306UPAAXX:6:1:465:216
 658GACCATGCCGCTTTTCTTGGCACGATTAACCCTTAT
 659>HWI-EAS91_1_306UPAAXX:6:1:844:628
 660TAATGTCAATAGATGTGGTAGAAGTCGTCATTTGGC
 661>HWI-EAS91_1_306UPAAXX:6:1:684:1444
 662TATCCCACAAAGTCCAGCGTACCATAAACGCAAGCC
 663>HWI-EAS91_1_306UPAAXX:6:1:515:1373
 664TAAGTTCATGAAGGATGGTGTTAATGCCACTCCTCT
 665>HWI-EAS91_1_306UPAAXX:6:1:764:1667
 666TTGAGTTCGATAATGGTGATATGTATGTTGACGTCC
 667>HWI-EAS91_1_306UPAAXX:6:1:1722:598
 668TGAGTTTATTGCTGCCGTCATTGCTTATTATGTTCT
 669>HWI-EAS91_1_306UPAAXX:6:1:670:1188
 670TTCTGTCAAAAACTGACGCGTTGGATGAGGAGAAGT
 671>HWI-EAS91_1_306UPAAXX:6:1:1682:1705
 672TAGCCACATAGAAACCAACAGCCATATAACTGGTAG
 673>HWI-EAS91_1_306UPAAXX:6:1:1008:1616
 674TCCTTTACTTGTCATGCGCTCTAATCTCTGTGCATC
 675>HWI-EAS91_1_306UPAAXX:6:1:490:1220
 676TAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCT
 677>HWI-EAS91_1_306UPAAXX:6:1:891:1437
 678TAATGGTGATATGTATGTTTACGTCCATAAGGCTGT
 679>HWI-EAS91_1_306UPAAXX:6:1:1310:321
 680TCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGT
 681>HWI-EAS91_1_306UPAAXX:6:1:827:1597
 682TGCGAGGTACTAAAGGCAAGCGTAAAGGCGCTCGTC
 683>HWI-EAS91_1_306UPAAXX:6:1:1062:1158
 684TAGAGTCAATAGCAAGGCCACGACGCAATGGAGAAA
 685>HWI-EAS91_1_306UPAAXX:6:1:1419:208
 686TGGCGCATAATCTCGGAAACCTGCTGTTGCTTGGAA
 687>HWI-EAS91_1_306UPAAXX:6:1:691:1018
 688AAATATCAACCACACCAGAAGCAGCATCAGTGACGA
 689>HWI-EAS91_1_306UPAAXX:6:1:374:113
 690GATAAAGCTGTTGCCGATACTTGGAACAATTTCTGT
 691>HWI-EAS91_1_306UPAAXX:6:1:1720:784
 692TGAGGATAAATTATGTCTAATATTCAAACTGGCGCC
 693>HWI-EAS91_1_306UPAAXX:6:1:1424:1394
 694ATAAAAATGATTGGCGTATCCAACCTGCAGAGTTTT
 695>HWI-EAS91_1_306UPAAXX:6:1:1063:1760
 696TAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCT
 697>HWI-EAS91_1_306UPAAXX:6:1:1235:729
 698TTTTTATGTCCCTCATCGTCACGTTTATGGTGAACA
 699>HWI-EAS91_1_306UPAAXX:6:1:167:1507
 700TAGTGTTATTAATATCAAGTTTTTGGAGCACATTGT
 701>HWI-EAS91_1_306UPAAXX:6:1:717:1569
 702TCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGT
 703>HWI-EAS91_1_306UPAAXX:6:1:610:765
 704TTCAGCGCCTTCCATGATGAGACAGGCCGTTTGAAT
 705>HWI-EAS91_1_306UPAAXX:6:1:663:380
 706TAAACATTCTGTGCCGCGTTTCTTTGTTCCTTATCT
 707>HWI-EAS91_1_306UPAAXX:6:1:790:1358
 708TTATCACCTTATTGAAGGCTTATCATTCATTTAGGT
 709>HWI-EAS91_1_306UPAAXX:6:1:965:1633
 710TAGATGTGGTAGAAGTCGTCATTTGGCGAGAAAGCT
 711>HWI-EAS91_1_306UPAAXX:6:1:673:319
 712TTCTTGCAAATCACCAGAAGGCGGTTCCTGAATGAT
 713>HWI-EAS91_1_306UPAAXX:6:1:684:371
 714TAGCGGTAAAGTTAGACCAAACCATGAAACCAACAT
 715>HWI-EAS91_1_306UPAAXX:6:1:1147:1444
 716ATCTGTCCACGGAGTGCTTAATCCAACTTACCAAGC
 717>HWI-EAS91_1_306UPAAXX:6:1:983:678
 718ATACCTGGTCTTTCGTATTCTGGCGTGAAGTCGCCG
 719>HWI-EAS91_1_306UPAAXX:6:1:1608:1119
 720TCACGCGGCGGCAAGTTGCCATACAAAACAGGGTCG
 721>HWI-EAS91_1_306UPAAXX:6:1:1048:1193
 722TAGTCAGGTTAAATTTAATGTGACCGTTTATCGCAT
 723>HWI-EAS91_1_306UPAAXX:6:1:1265:1429
 724ATATTTTTCATGGTATTGATAAAGCTGTTGCCGATT
 725>HWI-EAS91_1_306UPAAXX:6:1:1607:1677
 726TGTTGCTTGGAAAGATTGGTGTTTTCCATAATAGAC
 727>HWI-EAS91_1_306UPAAXX:6:1:1087:1421
 728ACGAACGTCAGAAGCAGCCTTATGGCCGTCAACATC
 729>HWI-EAS91_1_306UPAAXX:6:1:324:490
 730GCACCAAACATAAATCACCTCACTTAAGTGGCTGGG
 731>HWI-EAS91_1_306UPAAXX:6:1:1596:614
 732TTACCGCTACTAAATGCCGCGGATTGGTTTCGCTGT
 733>HWI-EAS91_1_306UPAAXX:6:1:343:83
 734GTTACGCAGTTTTGCCGCAAGCTGGCTGCTGTACGC
 735>HWI-EAS91_1_306UPAAXX:6:1:203:667
 736GCATGAATGTGCTTAATAGAGGCCAAGGCGGTCTAG
 737>HWI-EAS91_1_306UPAAXX:6:1:34:480
 738GGCAAGTTGCCATACAAAACAGGGTCGCCAGCAATT
 739>HWI-EAS91_1_306UPAAXX:6:1:606:1743
 740TAGCGACAGCTTGGTTTTTAGTGAGTTGTTCCATTC
 741>HWI-EAS91_1_306UPAAXX:6:1:254:1391
 742TATAATTACCCCAAAAAGAAAGGTATTAAGGATGAG
 743>HWI-EAS91_1_306UPAAXX:6:1:1568:1750
 744TAACCAGTAGTGTTAACAGTCGGGAGAGGAGTGGCT
 745>HWI-EAS91_1_306UPAAXX:6:1:1538:869
 746TACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCA
 747>HWI-EAS91_1_306UPAAXX:6:1:255:38
 748GTCAGGATTGACACCCTCCCAATTGTATGTTTTCAT
 749>HWI-EAS91_1_306UPAAXX:6:1:1543:1555
 750TAAAACGCCTCTAATCGGTCGTCAGCCAACGTGAGG
 751>HWI-EAS91_1_306UPAAXX:6:1:1365:733
 752AGAATCAGCGGTATGGCTCTTCTCCTTTTTTCGCTT
 753>HWI-EAS91_1_306UPAAXX:6:1:1604:943
 754TACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCT
 755>HWI-EAS91_1_306UPAAXX:6:1:1574:1632
 756TCAGTATGCAAATTAGCATAAGCAGCTTGCAGACCC
 757>HWI-EAS91_1_306UPAAXX:6:1:565:1799
 758TCTTGGTCAGTATGCAAATTAGCATAAGCAGCTTGC
 759>HWI-EAS91_1_306UPAAXX:6:1:1004:380
 760TATTGACTCTACTGTAGACATTTTTACTTTTTATTT
 761>HWI-EAS91_1_306UPAAXX:6:1:1345:965
 762ATTCAAAGGATAAACATCATAGGCAGTCGGGAGGGT
 763>HWI-EAS91_1_306UPAAXX:6:1:1704:756
 764TGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGG
 765>HWI-EAS91_1_306UPAAXX:6:1:310:1346
 766TATAACGTTGACGATGTAGCTTTAGTTTTCTTTAAA
 767>HWI-EAS91_1_306UPAAXX:6:1:900:1858
 768TTTACCGCTTCGGCGTTATAACCTCACACTCAATCT
 769>HWI-EAS91_1_306UPAAXX:6:1:1250:1741
 770TAAATCCAAAACGGCAGAAGCCTGAATGAGCTTAAT
 771>HWI-EAS91_1_306UPAAXX:6:1:1170:1317
 772TCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTC
 773>HWI-EAS91_1_306UPAAXX:6:1:149:1896
 774GCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATC
 775>HWI-EAS91_1_306UPAAXX:6:1:1504:494
 776TGTCTACAGTAGAGTCAATAGCAAGGCCACGACGCC
 777>HWI-EAS91_1_306UPAAXX:6:1:395:256
 778GTCCATATCTGACTTTTTGTTAACGTATTTATCCAC
 779>HWI-EAS91_1_306UPAAXX:6:1:1110:1109
 780ACCGCTTCGGCGTTATAACCTCACACTCAATCTTTT
 781>HWI-EAS91_1_306UPAAXX:6:1:895:649
 782TTCTGCACGTAATTTTTGACGCACGTTTTCTTCTGC
 783>HWI-EAS91_1_306UPAAXX:6:1:827:1378
 784TGCAAGCTGCTTATGCTAATTTGCATACTGACCAAG
 785>HWI-EAS91_1_306UPAAXX:6:1:1051:1587
 786TTTGACACTCTCACGTTGGCTGACGACCGATTAGAG
 787>HWI-EAS91_1_306UPAAXX:6:1:1656:1549
 788AACCTGCTGTTGCTTGGAAAGATTGGTGTTTTCCAT
 789>HWI-EAS91_1_306UPAAXX:6:1:366:150
 790GGTCAGTAGCAATCCAAACTTTGTTACTCGTCAGAA
 791>HWI-EAS91_1_306UPAAXX:6:1:955:1792
 792ATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTA
 793>HWI-EAS91_1_306UPAAXX:6:1:1340:1403
 794ATAAAATGCACCGCATGGAAATGAAGACGGCCATTA
 795>HWI-EAS91_1_306UPAAXX:6:1:1693:1017
 796TGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGT
 797>HWI-EAS91_1_306UPAAXX:6:1:1099:1572
 798AATTTTTACCGCTTCGGCGTTATAACCTCACACTCA
 799>HWI-EAS91_1_306UPAAXX:6:1:218:1148
 800TATGCAAATTAGCATAAGCAGCTTGCAGACCCATAT
 801>HWI-EAS91_1_306UPAAXX:6:1:403:614
 802TGGTGCTGATGCTTCCTCTGCTGGTATGGTTTACGC
 803>HWI-EAS91_1_306UPAAXX:6:1:1651:646
 804TCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGC
 805>HWI-EAS91_1_306UPAAXX:6:1:1566:499
 806TGCGGTGCATTTTATGCGGACACTTCCTACAGGTAG
 807>HWI-EAS91_1_306UPAAXX:6:1:825:951
 808ACAGGCCGTTTGAATGTTTACGGGGTGTACATAATA
 809>HWI-EAS91_1_306UPAAXX:6:1:1745:1865
 810TTAACTTCTGCGTCATGGAAGCGATAAAACTCTGCG
 811>HWI-EAS91_1_306UPAAXX:6:1:973:1992
 812TAGTAATTCCTGCTTTATCAAGATAATTTTTCGACT
 813>HWI-EAS91_1_306UPAAXX:6:1:171:1653
 814TAATAATGTTTTCCGTAAATTCAGCGCCTTCCATGT
 815>HWI-EAS91_1_306UPAAXX:6:1:397:363
 816TGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGT
 817>HWI-EAS91_1_306UPAAXX:6:1:1336:1155
 818ATATGTATGTTGACGGCCATAAGGCTGCTTCTGACG
 819>HWI-EAS91_1_306UPAAXX:6:1:685:629
 820AGTATGCAAATTAGCATAAGCAGCTTGCAGACCCAT
 821>HWI-EAS91_1_306UPAAXX:6:1:1409:510
 822ACATAATAAGCAATGACGGCAGCAATAAACTCAACA
 823>HWI-EAS91_1_306UPAAXX:6:1:1631:998
 824AACCATCAGCATGAGCCTGTCGCATTGCATTCATCC
 825>HWI-EAS91_1_306UPAAXX:6:1:260:1698
 826TTATTATGTTCATCCCGTCAACATTCAAACTGCCTT
 827>HWI-EAS91_1_306UPAAXX:6:1:578:971
 828TTAACGCTACTAAATTCCGCGGATTGGTTTCGTTGT
 829>HWI-EAS91_1_306UPAAXX:6:1:1613:642
 830ATAGAAATTTCACGCGGCGGCAAGTTGCCATACAAA
 831>HWI-EAS91_1_306UPAAXX:6:1:237:650
 832GACGGTATAATAACCACCATCATGGCGACCATTCAA
 833>HWI-EAS91_1_306UPAAXX:6:1:1100:1875
 834TTATGGTTCGTTCTTATTACCCTTCTGAATGTCACG
 835>HWI-EAS91_1_306UPAAXX:6:1:352:32
 836GTACCATAAACGCAAGCCTCAACGCAGCGACGAGCC
 837>HWI-EAS91_1_306UPAAXX:6:1:443:229
 838GCAGTAGGCGGAAAACGAACAAGCGCAAGAGTAAAC
 839>HWI-EAS91_1_306UPAAXX:6:1:1131:731
 840AGCAGTCGGCGTGTGAATCATTAGCCTTGCGACCCT
 841>HWI-EAS91_1_306UPAAXX:6:1:133:1089
 842AAGGTTAGTGCTGAGGTTGACTTAGTTCATCATCAA
 843>HWI-EAS91_1_306UPAAXX:6:1:65:1307
 844TGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTT
 845>HWI-EAS91_1_306UPAAXX:6:1:905:1493
 846TCAGCTTTACCGTCTTTCCAGAAATTGTTCCAAGTT
 847>HWI-EAS91_1_306UPAAXX:6:1:733:540
 848TGCCGCGGATTGGTTTCGCTGAATCAGGTTATTAAT
 849>HWI-EAS91_1_306UPAAXX:6:1:161:1707
 850TAATGTCGTCACTGATGCTGCTTCTGTTGTTGTTTT
 851>HWI-EAS91_1_306UPAAXX:6:1:380:1861
 852TCTGGGCATCTGGCTATGATGTTGATGGAACTGACC
 853>HWI-EAS91_1_306UPAAXX:6:1:1761:566
 854TATTGGTCGTATGGTTCTTGCTGCCGAGGGTCGCAT
 855>HWI-EAS91_1_306UPAAXX:6:1:1486:651
 856TGGCGGTATTTCTTCTTCTCTTTCTTGTTGCGCCCT
 857>HWI-EAS91_1_306UPAAXX:6:1:508:1380
 858TCCATCAACATCATAGCCAGATGCCCAGAGATTAGA
 859>HWI-EAS91_1_306UPAAXX:6:1:1763:855
 860TGTTTTGTATGGCAACTTGCCGCCGCGTGAAATTTC
 861>HWI-EAS91_1_306UPAAXX:6:1:1553:553
 862TAATTGCAGGGGCTTCGGCCCCTTACTTGAGGATAA
 863>HWI-EAS91_1_306UPAAXX:6:1:1424:507
 864TCCACTGCAACAACTGAACGGACTGGAAACACTGGT
 865>HWI-EAS91_1_306UPAAXX:6:1:988:135
 866TAAGCTGGTTCTCACTTCTGTTACTCCAGCTTCTTC
 867>HWI-EAS91_1_306UPAAXX:6:1:810:1918
 868TTTTCATCCCGAAGTTGCGGCTCATTCTGATTCTGT
 869>HWI-EAS91_1_306UPAAXX:6:1:588:559
 870TCTGGTTGAACGGCGTCGCGTCGTAACCCAGCTTGG
 871>HWI-EAS91_1_306UPAAXX:6:1:1264:1214
 872ATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCAC
 873>HWI-EAS91_1_306UPAAXX:6:1:1000:1475
 874TCCGTTCTGGTGATTCGTCTAAGAAGTTTAAGATTG
 875>HWI-EAS91_1_306UPAAXX:6:1:1389:160
 876TTATTCGCCACCATGATTATGACCAGTGTTTCCAGT
 877>HWI-EAS91_1_306UPAAXX:6:1:422:1296
 878TTCAACTACTCCGGTTATCGCTGGCGACTCCTTCGT
 879>HWI-EAS91_1_306UPAAXX:6:1:1273:856
 880TAGCCATAGCACCAGAAACAAAACTAGGGGCGGCCT
 881>HWI-EAS91_1_306UPAAXX:6:1:450:969
 882TGTTTTCCATAATAGACGCAACGCGAGCAGTAGACT
 883>HWI-EAS91_1_306UPAAXX:6:1:1202:828
 884ATCGTCAACGTTATATTTTGATAGTTTGACGTTTAT
 885>HWI-EAS91_1_306UPAAXX:6:1:1721:1800
 886GGGTTAGGGACATTAGAGCCTTGACTGACTGAGTTT
 887>HWI-EAS91_1_306UPAAXX:6:1:228:2019
 888TTGAGTAAGCATTTGGCGCATAATCTCGGAAACCTG
 889>HWI-EAS91_1_306UPAAXX:6:1:1579:1214
 890ACGTTTGGTCAGTTCCATCAACATCATAGCCAGATG
 891>HWI-EAS91_1_306UPAAXX:6:1:429:1055
 892TTTTGCCTGTTTGGTTCGCTTTGAGTCTTCTTCTTT
 893>HWI-EAS91_1_306UPAAXX:6:1:1359:1689
 894AAGAGCAGAAGCAATACCGCCAGCAATAGCACCAAA
 895>HWI-EAS91_1_306UPAAXX:6:1:1474:1056
 896TCCTCCTGAGACTGAGCTTTCTCGCCAAATGACGAC
 897>HWI-EAS91_1_306UPAAXX:6:1:105:1818
 898TTGGGGATTGAGAAAGAGTAGAAATGCCACAAGCCT
 899>HWI-EAS91_1_306UPAAXX:6:1:208:1538
 900TAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA
 901>HWI-EAS91_1_306UPAAXX:6:1:1361:1623
 902AATCCGTACGTTTCCAGACCGCTTTGGCCTCTATTA
 903>HWI-EAS91_1_306UPAAXX:6:1:595:1670
 904TGAATCTCTTTAGTCGCAGTAGGCGGAAAACGAACA
 905>HWI-EAS91_1_306UPAAXX:6:1:6:1885
 906TCTAATGTCGTCACTGATGCTGCTTCTGGTGTGTTT
 907>HWI-EAS91_1_306UPAAXX:6:1:706:1085
 908TGGTTCGTTCTTATTACCCTTCTGAATGTCACGCTG
 909>HWI-EAS91_1_306UPAAXX:6:1:1307:825
 910AGCGGTAAAGTTAGACCAAACCATGAAACCAACATA
 911>HWI-EAS91_1_306UPAAXX:6:1:762:802
 912TGGCATTAACACCATCCTTCATGAACTTAATCCACT
 913>HWI-EAS91_1_306UPAAXX:6:1:1657:506
 914TTGCGACCCTCGGCAGCAAGAACCATACGACCAATT
 915>HWI-EAS91_1_306UPAAXX:6:1:184:811
 916TTCTGATAAGCTGGTTCTCACTTCTGTTACTCCAGC
 917>HWI-EAS91_1_306UPAAXX:6:1:1469:1718
 918TGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCTTT
 919>HWI-EAS91_1_306UPAAXX:6:1:815:1640
 920TGGCGGCGATTGCGTACCCGACGACCCAAATTAGGG
 921>HWI-EAS91_1_306UPAAXX:6:1:1580:1388
 922AAGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTG
 923>HWI-EAS91_1_306UPAAXX:6:1:1617:1554
 924TACGGGGAAGGACGTCAATAGTCACACAGTCCTTGA
 925>HWI-EAS91_1_306UPAAXX:6:1:1544:431
 926TGATGCTAAAGGTGAGCCGCTTAAAGCTACCAGTTA
 927>HWI-EAS91_1_306UPAAXX:6:1:1604:1541
 928TCAGTGACGACATTAGAAATATCCTTTGCAGTAGCG
 929>HWI-EAS91_1_306UPAAXX:6:1:1485:741
 930ATCAAACGCTGAATAGTAAAGCCTCTACGCGATTTC
 931>HWI-EAS91_1_306UPAAXX:6:1:1226:393
 932TGCCACAAGCCTCAATAGCAGGTTTAAGAGCCTCGA
 933>HWI-EAS91_1_306UPAAXX:6:1:1506:973
 934ATTAGGGTCAACGCTACCTGTAGGAAGTGTCCGCAT
 935>HWI-EAS91_1_306UPAAXX:6:1:890:1838
 936TGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGC
 937>HWI-EAS91_1_306UPAAXX:6:1:453:1527
 938TAAGAGGGCGTTCAGCAGCCAGCTTGCGGCAAAACT
 939>HWI-EAS91_1_306UPAAXX:6:1:1056:570
 940ACATTGTAGCATTGTGCCAATTCATCCATTAACTTC
 941>HWI-EAS91_1_306UPAAXX:6:1:1736:74
 942TATCCGAAAGTGTTAACTTCTGCGTCATGGAAGCGT
 943>HWI-EAS91_1_306UPAAXX:6:1:169:1896
 944GTATGCAAATTAGCATAAGCAGCTTGCAGACCCATA
 945>HWI-EAS91_1_306UPAAXX:6:1:259:949
 946TGAGGATAAATTATGTCTAATATTCAAACTTGCTCC
 947>HWI-EAS91_1_306UPAAXX:6:1:1205:893
 948ATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCT
 949>HWI-EAS91_1_306UPAAXX:6:1:732:1335
 950TACTCGTGATTATCTTGCTGCTGCATTTCCTGAGCT
 951>HWI-EAS91_1_306UPAAXX:6:1:667:664
 952TCTGAGTCCGATGCTGTTCAACCACTAATAGGTAAG
 953>HWI-EAS91_1_306UPAAXX:6:1:535:587
 954TTAGAGGCGTTTTATGATAATCCCAATGCTTTGCGT
 955>HWI-EAS91_1_306UPAAXX:6:1:412:446
 956GTGTGGTTGATATTTTTCATGGTATTGATAAAGCTT
 957>HWI-EAS91_1_306UPAAXX:6:1:507:1599
 958TTGCTGGCGGTTTTTCTTTTTTTTTTTTTTTTTTTT
 959>HWI-EAS91_1_306UPAAXX:6:1:575:1818
 960TAAAATGCACCGCATGGAAATGAAGACGGCCATTAG
 961>HWI-EAS91_1_306UPAAXX:6:1:1568:1428
 962ACCAGTTATATGGCTGGTTGTTTTTTTTTTTTTTTT
 963>HWI-EAS91_1_306UPAAXX:6:1:1417:982
 964AACAAGAGAATCTCTACCATGAACAAAATGTGACTC
 965>HWI-EAS91_1_306UPAAXX:6:1:280:1340
 966GGCCAAACCAGTGGCGATGGCCGCGCTGGAGGTTTT
 967>HWI-EAS91_1_306UPAAXX:6:1:966:144
 968TACTAAATGCCGCGGATTGGTTTCGCTGAATCAGGT
 969>HWI-EAS91_1_306UPAAXX:6:1:1391:1987
 970TAATAATGTTTTCCGTAAATTCAGCGCCTTCCATGT
 971>HWI-EAS91_1_306UPAAXX:6:1:1280:278
 972ATGGAAATGAAGACGGCCATTAGCTGTACCATACTC
 973>HWI-EAS91_1_306UPAAXX:6:1:631:858
 974TGATATTGGTCGTATGGTTCTTGCTTCCGTGGGTCT
 975>HWI-EAS91_1_306UPAAXX:6:1:518:573
 976TTAGGTGTCTGTAAAACAGGTGCCGAAGAAGCTGGT
 977>HWI-EAS91_1_306UPAAXX:6:1:54:981
 978TTGACATTTTAAAAGAGCGTGGATTACTATCTGATT
 979>HWI-EAS91_1_306UPAAXX:6:1:218:1165
 980TATTGACTCTACTGTAGACATTTTTACTTTTTATTT
 981>HWI-EAS91_1_306UPAAXX:6:1:1727:1530
 982TCAACGCAGCGACGAGCACGAGAGCGGTCAGTAGCA
 983>HWI-EAS91_1_306UPAAXX:6:1:519:657
 984TGAACAGCATCGGACTCAGATAGTAATCCACGCTCT
 985>HWI-EAS91_1_306UPAAXX:6:1:939:967
 986ATACCGTCAAGGACTGTGTGACTATTGACGTCCTTC
 987>HWI-EAS91_1_306UPAAXX:6:1:299:1060
 988TATAACTGGTAGCTTTAAGCGGCTCACCTTTAGCAT
 989>HWI-EAS91_1_306UPAAXX:6:1:438:665
 990TAATTCGTAAACAAGCAGTAGTAATTCCTGCTTTAT
 991>HWI-EAS91_1_306UPAAXX:6:1:1303:1971
 992AGCATTGTGCCAATTCATCCATTAACTTCTCAGTAA
 993>HWI-EAS91_1_306UPAAXX:6:1:214:1264
 994TCAGCACCAACAGAAACAACCTGATTAGCGGCGTTG
 995>HWI-EAS91_1_306UPAAXX:6:1:1454:1423
 996AACGGAAAACATCCTTCATAGAAATTTCACGCGGCG
 997>HWI-EAS91_1_306UPAAXX:6:1:1633:340
 998TTCCATAATAGACGCAACGCGAGCAGTAGACTCCTT
 999>HWI-EAS91_1_306UPAAXX:6:1:671:1196
1000ATACGAAAAGACAGAATCTCTTCCAAGAGCTTGATG