PageRenderTime 110ms CodeModel.GetById 104ms app.highlight 2ms RepoModel.GetById 1ms app.codeStats 0ms

/test-data/extract_genomic_dna_out7.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 17 lines | 17 code | 0 blank | 0 comment | 0 complexity | 53c04bf3c101e018c67623f94143d379 MD5 | raw file
 1>mm9_test_chromosome_53_550_+
 2TACTATCTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCCAC
 3TACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAG
 4CGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTAC
 5GTATTTGGCGCGCGGCGCTACGGCTGAGCGTCGAGCTTGCGATACGCCGT
 6AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
 7AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAC
 8TATTACTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACTGT
 9AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
10AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGTT
11TTCTACTTGAGACTGGGATCGAGGCGGACTTTTTAGGACGGGACTTGCTA
12CTATCTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCCACTA
13CGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCG
14ACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGT
15ATTTGGCGCGCGGCGCTACGGCTGAGCGTCGAGCTTGCGATACGCCACTA
16TTACTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACTTTTT
17CTACTTGAGACTGGGATCGAGGCGGACTTTTTAGGACGGGACTTGC