PageRenderTime 47ms CodeModel.GetById 33ms app.highlight 2ms RepoModel.GetById 6ms app.codeStats 0ms

/test-data/rhodopsin_nucs.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 161 lines | 156 code | 5 blank | 0 comment | 0 complexity | 724df4a03dbd758859586fb98f4eec56 MD5 | raw file
  1>gi|57163782|ref|NM_001009242.1| Felis catus rhodopsin (RHO), mRNA
  2ATGAACGGGACGGAGGGCCCGAACTTCTACGTGCCCTTCTCCAACAAAACGGGTGTGGTACGCAGCCCCT
  3TCGAGTACCCACAGTACTACCTGGCTGAGCCATGGCAGTTCTCCATGCTGGCCGCCTACATGTTCCTGCT
  4CATCGTGCTTGGCTTCCCCATCAACTTCCTCACGCTCTACGTCACGGTCCAGCACAAGAAGCTGCGCACG
  5CCTCTCAACTACATCCTGCTCAACCTGGCCGTGGCTGACCTCTTCATGGTCTTCGGTGGCTTCACCACCA
  6CCCTCTACACCTCTCTGCATGGATACTTTGTCTTTGGGCCCACAGGATGCAATTTGGAGGGCTTCTTTGC
  7CACACTGGGCGGTGAAATTGCCCTGTGGTCTTTGGTGGTCCTGGCCATTGAGCGGTACGTGGTGGTGTGT
  8AAGCCCATGAGCAACTTCCGCTTTGGGGAGAACCATGCCATAATGGGCGTCGCTTTCACCTGGGTCATGG
  9CACTGGCCTGCGCTGCACCCCCCCTCGTTGGTTGGTCCAGGTACATCCCTGAAGGCATGCAGTGTTCATG
 10CGGGATCGACTACTACACACTCAAGCCAGAAGTCAACAACGAGTCCTTTGTCATCTACATGTTCGTGGTC
 11CACTTCACCATCCCCATGATCGTCATCTTCTTTTGCTACGGGCAGCTTGTCTTCACAGTCAAGGAGGCGG
 12CAGCCCAGCAGCAGGAGTCAGCCACCACCCAGAAGGCTGAGAAGGAGGTCACTCGCATGGTCATCATCAT
 13GGTCATTGCTTTCCTGATCTGTTGGGTGCCCTACGCCAGCGTGGCATTCTACATCTTCACCCACCAGGGG
 14TCCAACTTTGGCCCCATCTTCATGACACTCCCGGCGTTCTTCGCAAAGTCCTCCTCCATCTACAACCCTG
 15TCATCTACATCATGATGAACAAGCAGTTCCGGAACTGCATGCTCACTACCCTCTGCTGTGGCAAGAACCC
 16ACTGGGTGATGACGAGGCTTCCACAACCGGTTCCAAGACGGAGACCAGCCAGGTGGCACCGGCCTAA
 17
 18>gi|2734705|gb|U59921.1|BBU59921 Bufo bufo rhodopsin mRNA, complete cds
 19TCTTTCTAGTTTGGGGGGGGGGACTTTAAAGAGCCGCCAATATGAACGGAACAGAAGGCCCAAACTTTTA
 20CATACCCATGTCCAACAAGACTGGGGTGGTGCGAAGCCCCTTTGAATACCCTCAGTATTACCTGGCAGAG
 21CCATGGCAATATTCCATTCTGTGCGCGTACATGTTCCTGCTCATTCTACTTGGGTTCCCAATCAACTTCA
 22TGACCTTGTACGTCACCATCCAGCACAAGAAGCTCCGGACACCCTTAAACTATATCCTGCTGAATTTGGC
 23CTTTGCCAACCACTTCATGGTCCTGTGTGGATTCACGGTGACAATGTACTCCTCAATGAACGGATACTTC
 24ATCCTCGGAGCCACCGGTTGCTATGTTGAAGGCTTCTTCGCTACCCTTGGTGGTGAAATCGCCCTTTGGT
 25CCCTGGTGGTCTTGGCCATTGAACGATACGTGGTCGTCTGTAAGCCCATGAGCAACTTCCGATTTAGTGA
 26GAACCATGCCGTCATGGGCGTAGCGTTCACCTGGATAATGGCTTTGTCCTGTGCTGTTCCTCCACTCCTT
 27GGATGGTCCAGGTACATCCCCGAGGGCATGCAGTGCTCCTGCGGAGTCGACTACTACACCCTGAAGCCCG
 28AGGTCAACAACGAGTCCTTCGTCATCTACATGTTCGTCGTCCACTTCACCATCCCCCTGATTATCATTTT
 29CTTCTGCTATGGCCGCCTGGTGTGCACTGTGAAAGAGGCTGCAGCTCAACAGCAAGAGTCCGCCACCACC
 30CAGAAGGCCGAGAAAGAGGTGACCAGGATGGTGATCATCATGGTGGTCTTCTTCCTTATCTGTTGGGTCC
 31CCTACGCCTCTGTCGCTTTCTTCATCTTCAGCAATCAGGGCTCTGAGTTCGGCCCCATCTTCATGACCGT
 32CCCAGCTTTCTTTGCCAAGAGTTCTTCCATCTACAACCCCGTCATCTACATCATGCTCAACAAGCAGTTC
 33CGTAACTGCATGATCACCACCCTGTGCTGCGGCAAGAATCCCTTTGGAGAAGACGATGCCTCCTCTGCCG
 34CCACCTCCAAGACAGAGGCTTCTTCTGTTTCTTCCAGCCAGGTGTCTCCTGCATAAGACCTTCCACCAGG
 35CCTGTCTCAGGGTCCGCTGCCTCACACAGCTCCCACCGCCCCAACTCCGTCTCCTGCTCGCTAAGGCGGC
 36GAAGTTCCCCTTCCATTACATAAAACGTATCTGTTCAAGAAAGGCGACGACGAAGGAGAAGAAGAGGAGC
 37CCCCCCGAACCCCTTCGCTGCTGCTGAAAACGACTTGATTGCTTCTGCAACGCAACGGGGCCTTACGGCA
 38GCGAAGGGGTTGTCATCCGGACGCGCCAAGAATTCCTTCGAGACTGTAAATATCTTAAAGGAACCGTCCT
 39GCTAGTTACCGACGCCGCTCCTGTAGCCGCCGTTCCCCCGCACTCCGGCCGGTTCATACCTCTTATTTTT
 40TTGCAATGCAACAGAAAATAATATTTTTGTTCCCACGGCTTTTCCCGGTCAGGTCTGGTAGTGGCGGAGA
 41TTGGCCGACCCCTCGCACCTGTAATAAAGCGCAG
 42
 43>gi|283855845|gb|GQ290303.1| Cynopterus brachyotis voucher 20020434 rhodopsin (RHO) gene, exons 1 through 5 and partial cds
 44GTGCCCTTCTCCAACAAGACAGGCGTGGTGCGCAGTCCCTTCGAGCATCCACAGTACTACCTGGCCGAGC
 45CATGGCAGTTCTCCATGCTGGCCGCCTACATGTTTCTGCTGATCGTGCTCGGCTTCCCCATCAACTTCCT
 46CACGCTCTATGTCACGGTTCAGCACAAGAAGCTGCGTACGCCTCTCAACTACATCCTGCTCAACCTGGCC
 47GTGGCCGACCTCTTCATGGTCTTCGGAGGCTTCACCACCACCCTCTACACCTCCCTGCATGGATACTTTG
 48TCTTCGGGCCTACGGGATGCAATCTGGAGGGCTTTTTTGCCACCCTGGGAGGTATGAGCTGAGATGCGGG
 49TAAGGAGGAGGCATAGAGGCATCTGGGAACAGTCCCAAGCTTGGGGTGAAGGCTAAGAGGCCTTCTTCCT
 50TGTTCTGTCATTGGCGTCGTCCGAAGCCCTCACTTAATCAACAAACAGTTTGGTGGTGAGGCGCTGAGCT
 51CCATTTGGAGAGGGCAGGTATCGAGCACTGTTTTATCCCCCCTGGAGTGGTGCCATTGCCTTGCTTTACA
 52GCAAAGAAACTGAGGATGAGAGGAGTCGAGGGTCTTGCCAGGTCACATCATGGCAGAGACAGAGCTGAGT
 53TTCAACCCTGCATCTATGTGCAGTTTCCCTTGGAGCAGCTATGTTAGGTCAGACCCACGGTGGGCACTGG
 54GGAGAGAGCTGCACAAGACAGGTCCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
 55NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCTGATTGCCA
 56GGAGTGATGTGCAGCGCAAATGTCTGAATTCCATTATTATGTGCTCCTTCTTCCTCTGAGCCAAACATCC
 57ATCTTCATGGCTCCTAGAATTGGGTCCCACCCACATGAGCAGGTCATTTTGTTTCCCTAGAGGGGAGAGG
 58TCACTGCTGTGGAGGGAGGGAAGGTTCGTCCCGCTCCATGTTTCTGTTGTCTCTGCAATGCCTTTCTCTA
 59GGGACTCTGCCTATTGCCCCAAGAAGGACACATTCTTCTGTAAAAACTCCCTCCTGGGTTCCCAGTCTAA
 60TCAAGACCTCTAAACTGATTTCCATGTCCCTCATGAACCCAAAGCTCTAACTGAATTAAACTTCTCAGGA
 61CTTACTCCACTCTCCTCGTCCATCATGCAGCCCCTCTGCCCAGCACCCTATCTCCTCTTCTTCCCAGTGT
 62CTGAGCCCACTGTACCCTGAGACTTCGCTCCAGGCCTGCCCCAGGCTGCCTTCTCAGGTGCCCTCTCCCA
 63CATAGGAGGAGCACGGCCTCCTTAGACAGACGTGGGGTGCAGGTTGGTGGCATGCTGACTGATAGCTGAC
 64TGCCTTGCAGGTGAAATTGCCCTGTGGTCCTTGGTGGTCCTGGCCATCGAGCGGTACGTGGTGGTATGCA
 65AGCCCATGAGCAACTTCCGCTTCGGGGAGAACCACGCCATCATGGGCCTTGCCCTCACCTGGGTCATGGC
 66ACTGGCCTGCGCCGCGCCCCCGCTAGTCGGCTGGTCCAGGTAATGGCACTGAACAGAAGGGAAGTGCCTC
 67TGAGGTCTTCTTAGGGTCCCCCAGCTGGGACTCAAACCTAGGGCTGTCTGGTTCCAGGCACGGAACTGGC
 68GACTCCACTGGGGTTGGGGTTTAGGGCAAGGAAGGAGAGGATCAGACCCTAATGTTGTTACGTGGGTTGG
 69TCCGCATGTCAAGGAGAATCCAAGACACCCAATCCTTCACCTTGGCTGTGCCCCTAATCCTCATCTAAGC
 70CAGGTTCAGATTCCAATCCTCTTTGGCCCAGTGCTCCGTGGGAAGCTCCCTCTGACCTTGGGCCTCAGCG
 71CCTGGGGTTGCTGAGCCTTCCTAGTATAGGTGGTGACATCGTAGCCCCTGGGACCTGGATCCTGCCCAGT
 72CTGCAGGCCATCATCTCCAAATGGGGCTGAGATGAGATGTGAGGAAAGAGGGGAGACAGTGGTTTGGAAA
 73ACTGGACTGGTGGCTTTTTTGGGTTTCCAGAGGACTCATCTTCCTCTGCTTCTAGAATATTCCCACTCTC
 74TCTTCCCTTTCCTCATTCTTCCTGGGTTATTTTTTTTTCCCTTTGCTGAATTCGAGCCCCATTCCCTCCA
 75GCCTCTTTCCCTGTCTTATCTAGCCCAGTCCAGTTATATTCTCATAGGCAGAGGCAACAGATGCTCCAAA
 76TTTTCTGAGGTCGGTTCCAACATCGCCACCCTCTAAAATCAGTGAAACATCCTAACTACATGCCTCATAG
 77TCCTCCTGTTTCCAAAAACTGCAAAGATCTCCTGGTTACCCTGTATGCCCATCTTTGGGCTAGAAAATCC
 78TCTCACCCTGTTAATAGTAAGACCCTGGTTTGTACAAACTGCCTCAAACACAGAGTTTAGGGGCTTTTCC
 79CTTCTCTCCGCCAACCTCTGACAGGCAGAGTCTGAGGCCTGGCCTCCAGCTGCTGCGGGGAGCAGGTCTG
 80GTAAAGAATCCTGTGCAGGTCAGTGGTATACAGGTCCTGTCAGGTGACAGCCTGGGCGAGAGACTGGAAA
 81GTATCAGGATAACACGGCTGCCAGACGAACAACAAAACAACACTGAATTCACAAGGCGCATTCGAATCCT
 82CTCTCAGTCCATTTGATCCTCAGTCACACAGCCGAGTAGACACTTTATCAACTCATTTAACAGAAAGGGA
 83AAGTGAAGCCCAGAGCGAGGCCAGCAACGTGGCAGGTCACTCTGGTCATCTAGGGCCTGTTCCCAACTCT
 84TTCACATGTGGGTCTCCAATATGTTCCCTCCTGTCCCAATCTCTGCCGGCCCTCAGGTACATCCCAGAGG
 85GCATGCAGTGCTCATGTGGAATCGACTACTACACCCTCAAGCCGGAGGTCAACAACGAGTCCTTTGTCAT
 86CTACATGTTCGTGGTCCACTTCACCATCCCTATGATTGTCATATTCTTTTGCTATGGACAGCTGGTCTTC
 87ACCGTCAAGGAGGTAAGGTCATGTGTTGGGCACTGGGGACATGCACACTGAGTGAATGGAGCCCAGCTCC
 88ATTCCCAGAGTTGCCACAGTCTGGACACCTGACCTTGTGTCCCTGCAGGCAGCTGCCCAGCAGCAGGAGT
 89CAGCCACCACCCAGAAGGCCGAGAAGGAGGTCACCCGTATGGTCATCATCATGGTCATTGCTTTCCTAAT
 90CTGTTGGCTGCCGTATGCCGGCGTGGCATTCTACATCTTCACCCACCAGGGCTCTAACTTTGGCCCCATC
 91TTCATGACCCTCCCGGCATTCTTTGCCAAGTCGTCCTCCATCTACAACCCTGTCATCTATATCATGATGA
 92ACAAGCAGGTGCCAGGTGGTAGGGAGGGAGGGTCTGGGTCCCCCAGGCTGCAGGCACTGCCCACAGAGGA
 93CAAGCCACATCCTTGACTAGGCAGACCCCAGTCTTCCCATCTGCAAAATTAGGCAGGGGAGTTCGTCTCC
 94CCCAGGCATCAGAGACATCGGGGAGAAATGCACATTTCTGGAGATGAATCAGCATCTCAGGGTGGGCCCA
 95GGAACCTGCACTTCTAAAAACCATTCCACATGACTCTGAGGCTAGCATGAGAAGTGATGATCCACATGGT
 96TCTGGAGGCCTGCTTTAAAAGTCAAGTGGTCAAAGTCCCAAGCCTGGGAACGGGATGGTGCCAGTCTCCA
 97TTAAAGAGATCAAAAGGAGCTAGAAAGTCTTGTGATGAAAGATGAAGGGATAAAGCCGTCCTTTAACACA
 98GATCAGTGATTTCTCTGCAGAATCCATGACCCAGTGGGAAAAAGTGGTCCCTGGAGTCAGGCATATTGGA
 99TTCAAATCCTAGCTCTGCTATTTTCTAGCTATGTAACCTTGGGCAAGTCATCTCCCTTCTCTGTGCTTCA
100GTTTCTTCTTTCATAGAAAGGGTAAAATCCCAAACTCTTGGGTTAAATGAGATAACTTACATAGCCCTTG
101ATATGCAGAGGCATTATGGAATGTCGTTAGTGACAAAGTTCCCTTGGGTTTGGTCCCTGGTATCTCTGGA
102GTGAGATTGCATATGTTCCCTTCAGAGGGTCAGATTTGGGATGAGAGTGGAGGCTGCGAGGGCCTGAGTG
103GGAAGGGATTGGAGGCAAATCTCACCAACCATGTCAGTTTGCTACACACACTTTGGGTGGACCCTGACCC
104TGACTCATGCTTCTTGCCTTCCAGTTCCGGAACTGCATGCTCACTACCCTCTGCTGTGGCAAGAACCCAC
105TGGGTGACGATGAGGCCTCCACCACTGCCTC
106
107>gi|283855822|gb|GQ290312.1| Myotis ricketti voucher GQX10 rhodopsin (RHO) mRNA, partial cds
108GTGCCCTTCTCCAACAAGACGGGTGTGGTGCGCAGCCCCTTCGAGTACCCGCAGTACTACCTGGCTGAGC
109CCTGGCAGTTCTCCATGCTGGCTGCCTACATGTTTCTGCTGATCGTGCTCGGATTCCCCATCAACTTCCT
110CACGCTCTACGTCACCGTCCAGCACAAGAAGCTGCGCACGCCTCTCAACTACATCCTGCTCAACCTGGCT
111GTGGCCAACCTCTTCATGGTCTTTGGAGGCTTCACCACCACCCTGTATACCTCTATGCATGGATACTTCG
112TCTTCGGGGCCACGGGATGCAATCTGGAGGGCTTCTTTGCCACGCTGGGCGGTGAAATCGCCCTGTGGTC
113CCTGGTGGTCCTGGCCATCGAGCGGTATGTGGTGGTCTGCAAGCCCATGAGCAACTTCCGCTTTGGGGAG
114AACCACGCCATCATGGGCCTCGCCTTCACGTGGGTCATGGCACTGGCCTGCGCTGCACCCCCACTAGCCG
115GCTGGTCCAGGTACATCCCAGAGGGCATGCAGTGCTCGTGTGGGATTGACTACTACACGCTCAAACCGGA
116GGTCAACAACGAGTCCTTCGTCATCTACATGTTCGTGGTCCACTTCACCATCCCCATGATTGTCATTTTC
117TTCTGCTACGGACAGCTGGTGTTCACAGTGAAGGAGGCGGCTGCCCAGCAGCAGGAGTCAGCCACCACCC
118AGAAGGCCGAGAAGGAAGTCACGCGCATGGTCATCATCATGGTCGTTGCGTTCCTAATCTGTTGGCTGCC
119CTACGCCAGCGTGGCATTCTACATCTTTACCCACCAGGGCTCTAACTTTGGCCCTGTCTTCATGACCATC
120CCGGCATTCTTCGCCAAGTCATCCTCCATCTACAACCCGGTCATCTATATCATGATGAACAAGCAGTTCC
121GGAACTGCATGCTCACCACCCTCTGCTGTGGCAAGAACCCACTGGGTGATGACGAAGCATCCACCACTGC
122CTC
123
124>gi|18148870|dbj|AB062417.1| Synthetic construct Bos taurus gene for rhodopsin, complete cds
125ATGAACGGGACCGAGGGCCCAAACTTCTACGTGCCTTTCTCCAACAAGACGGGCGTCGTACGCAGCCCCT
126TCGAGGCGCCGCAGTACTACCTGGCTGAGCCATGGCAGTTCAGCATGCTGGCCGCCTACATGTTCCTGCT
127GATCATGCTTGGCTTCCCCATCAACTTCCTCACGCTGTACGTCACAGTCCAGCACAAGAAGCTGAGGACC
128CCCCTCAACTACATCCTGCTCAACCTGGCCGTGGCAGATCTCTTCATGGTGTTCGGGGGCTTCACCACCA
129CCCTGTATACCTCTCTGCACGGGTACTTCGTGTTCGGTCCGACGGGCTGCAACCTCGAGGGCTTCTTTGC
130CACCTTAGGCGGTGAAATTGCACTGTGGTCCTTGGTGGTGCTAGCCATCGAGCGGTACGTAGTGGTGTGC
131AAGCCCATGAGCAACTTCCGCTTCGGGGAGAACCACGCCATCATGGGCGTCGCATTCACCTGGGTCATGG
132CTCTGGCCTGTGCGGCCCCCCCCCTCGTCGGCTGGTCTAGATACATCCCGGAGGGGATGCAGTGCTCGTG
133CGGGATCGATTACTACACGCCCCACGAGGAGACCAACAATGAGTCGTTCGTCATCTACATGTTCGTTGTA
134CACTTCATCATCCCCCTGATTGTCATATTCTTCTGCTACGGGCAGCTGGTCTTCACCGTCAAGGAGGCTG
135CAGCCCAGCAGCAGGAGTCGGCCACCACTCAGAAGGCCGAGAAGGAGGTCACGCGTATGGTCATCATCAT
136GGTCATCGCTTTCCTCATATGCTGGCTGCCCTACGCAGGTGTGGCGTTCTACATCTTCACCCATCAGGGA
137TCCGACTTTGGCCCCATCTTCATGACCATCCCGGCTTTCTTTGCCAAGACGTCTGCCGTCTATAACCCCG
138TCATCTACATCATGATGAACAAGCAGTTCCGGAACTGCATGGTCACCACTCTCTGCTGTGGCAAGAACCC
139CCTAGGTGACGACGAGGCCTCCACGACCGTGTCCAAGACAGAGACCAGCCAAGTGGCCCCTGCCTAA
140
141>gi|12583664|dbj|AB043817.1| Conger myriaster conf gene for fresh water form rod opsin, complete cds
142CCGCTACTGACGAACCGCAACCATGAACGGCACTGAGGGACCTAACTTCTACATCCCCATGTCAAACGCC
143ACTGGTGTAGTGAGGAGTCCATTTGAATACCCGCAGTACTACCTTGCAGAACCATGGGCTTTCTCAGCTC
144TGTCTGCCTACATGTTCTTCCTGATTATCGCCGGATTCCCCATCAACTTCCTCACCCTGTATGTCACCAT
145CGAACATAAGAAACTGAGGACCCCACTGAACTACATTCTGCTGAACCTGGCCGTGGCCGACCTCTTCATG
146GTGTTTGGCGGATTCACCACCACGATGTACACCTCCATGCACGGCTACTTTGTCTTCGGCCCCACCGGCT
147GCAACATCGAAGGGTTCTTCGCCACCCTCGGCGGCGAGATTGCCCTCTGGTGCCTCGTTGTCCTGGCCAT
148TGAAAGGTGGATGGTCGTCTGCAAGCCAGTGACCAATTTCCGCTTCGGTGAGAGCCATGCCATCATGGGT
149GTCATGGTGACCTGGACCATGGCATTGGCCTGTGCCCTCCCCCCTCTCTTCGGCTGGTCTCGGTACATTC
150CGGAAGGTCTGCAGTGCTCGTGCGGGATCGACTACTATACCCGGGCGCCTGGGATCAACAATGAGTCCTT
151TGTGATCTACATGTTTACCTGCCACTTCTCCATCCCACTCGCCGTCATCTCTTTCTGCTACGGCCGACTG
152GTGTGCACCGTCAAAGAGGCCGCTGCCCAGCAACAGGAGTCCGAGACCACCCAGAGGGCTGAGCGGGAGG
153TCACCCGCATGGTCGTCATCATGGTCATCTCCTTCCTGGTCTGCTGGGTGCCCTATGCCAGTGTGGCCTG
154GTACATCTTTACCCACCAGGGAAGCACTTTTGGGCCCATCTTCATGACCATTCCATCCTTCTTTGCCAAG
155AGTTCAGCCCTCTACAACCCCATGATCTACATCTGCATGAACAAGCAGTTCCGCCATTGCATGATCACCA
156CCCTCTGCTGTGGGAAGAACCCCTTCGAGGAGGAGGATGGAGCGTCCGCCACTAGCTCTAAAACTGAGGC
157TTCATCCGTGTCCTCCAGCTCTGTCTCCCCGGCATAAACCTTGTTTGACCGAACACCACGCATCAACACA
158AAGACCAAGAATGCTGACTAAATGCTAACATTTCAGGGAAATCCAAAGACTTTTTACTATTTTTTTACAC
159AACCATATAGGTTGCAAACAGAGGTTTAGCCCTGTTTACAGGTTGTCATCAATGTGATGTCAGTATGTAC
160AATATAGTCAACTTGATAGCAAGTTGTTGGCTTATTTCAGATTGTATGGGCAATGTAATCAACCATATGT
161GAAATAAATTGCAA