PageRenderTime 27ms CodeModel.GetById 14ms app.highlight 6ms RepoModel.GetById 1ms app.codeStats 0ms

/test-data/chr_m.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 335 lines | 335 code | 0 blank | 0 comment | 0 complexity | cf4fff9dc33d38810f5f05d06b5ab4b3 MD5 | raw file
  1>chrM
  2GTTAATGTAGCTTAATAATATAAAGCAAGGCACTGAAAATGCCTAGATGA
  3GTATTCTTACTCCATAAACACATAGGCTTGGTCCTAGCCTTTTTATTAGT
  4TATTAATAGAATTACACATGCAAGTATCCGCACCCCAGTGAGAATGCCCT
  5CTAAATCACGTCTCTACGATTAAAAGGAGCAGGTATCAAGCACACTAGAA
  6AGTAGCTCATAACACCTTGCTCAGCCACACCCCCACGGGACACAGCAGTG
  7ATAAAAATTAAGCTATGAACGAAAGTTCGACTAAGTCATATTAAATAAGG
  8GTTGGTAAATTTCGTGCCAGCCACCGCGGTCATACGATTAACCCAAATTA
  9ATAAATCTCCGGCGTAAAGCGTGTCAAAGACTAATACCAAAATAAAGTTA
 10AAACCCAGTTAAGCCGTAAAAAGCTACAACCAAAGTAAAATAGACTACGA
 11AAGTGACTTTAATACCTCTGACTACACGATAGCTAAGACCCAAACTGGGA
 12TTAGATACCCCACTATGCTTAGCCCTAAACTAAAATAGCTTACCACAACA
 13AAGCTATTCGCCAGAGTACTACTAGCAACAGCCTAAAACTCAAAGGACTT
 14GGCGGTGCTTTACATCCCTCTAGAGGAGCCTGTTCCATAATCGATAAACC
 15CCGATAAACCCCACCATCCCTTGCTAATTCAGCCTATATACCGCCATCTT
 16CAGCAAACCCTAAACAAGGTACCGAAGTAAGCACAAATATCCAACATAAA
 17AACGTTAGGTCAAGGTGTAGCCCATGGGATGGAGAGAAATGGGCTACATT
 18TTCTACCCTAAGAACAAGAACTTTAACCCGGACGAAAGTCTCCATGAAAC
 19TGGAGACTAAAGGAGGATTTAGCAGTAAATTAAGAATAGAGAGCTTAATT
 20GAATCAGGCCATGAAGCGCGCACACACCGCCCGTCACCCTCCTTAAATAT
 21CACAAATCATAACATAACATAAAACCGTGACCCAAACATATGAAAGGAGA
 22CAAGTCGTAACAAGGTAAGTATACCGGAAGGTGTACTTGGATAACCAAAG
 23TGTAGCTTAAACAAAGCATCCAGCTTACACCTAGAAGATTTCACTCAAAA
 24TGAACACTTTGAACTAAAGCTAGCCCAAACAATACCTAATTCAATTACCC
 25TTAGTCACTTAACTAAAACATTCACCAAACCATTAAAGTATAGGAGATAG
 26AAATTTTAACTTGGCGCTATAGAGAAAGTACCGTAAGGGAACGATGAAAG
 27ATGCATTAAAAGTACTAAACAGCAAAGCTTACCCCTTTTACCTTTTGCAT
 28AATGATTTAACTAGAATAAACTTAGCAAAGAGAACTTAAGCTAAGCACCC
 29CGAAACCAGACGAGCTACCTATGAACAGTTACAAATGAACCAACTCATCT
 30ATGTCGCAAAATAGTGAGAAGATTCGTAGGTAGAGGTGAAAAGCCCAACG
 31AGCCTGGTGATAGCTGGTTGTCCAGAAACAGAATTTCAGTTCAAATTTAA
 32ATTTACCTAAAAACTACTCAATTCTAATGTAAATTTAAATTATAGTCTAA
 33AAAGGTACAGCTTTTTAGATACAGGTTACAACCTTCATTAGAGAGTAAGA
 34ACAAGATAAACCCATAGTTGGCTTAAAAGCAGCCATCAATTAAGAAAGCG
 35TTCAAGCTCAACGACACATCTATCTTAATCCCAACAATCAACCCAAACTA
 36ACTCCTAATCTCATACTGGACTATTCTATCAACACATAGAAGCAATAATG
 37TTAATATGAGTAACAAGAATTATTTCTCCTTGCATAAGCTTATATCAGAA
 38CGAATACTCACTGATAGTTAACAACAAGATAGGGATAATCCAAAAACTAA
 39TCATCTATTTAAACCATTGTTAACCCAACACAGGCATGCATCTATAAGGA
 40AAGATTAAAAGAAGTAAAAGGAACTCGGCAAACACAAACCCCGCCTGTTT
 41ACCAAAAACATCACCTCTAGCATTTCCAGTATTAGAGGCACTGCCTGCCC
 42AGTGACATCTGTTtaaacggccgcggtatcctaaccgtgcaaaggtagca
 43taatcacttgttccctaaatagggacttgtatgaatggccacacgagggt
 44tttactgtctcttacttccaatcagtgaaattgaccttcccgtgaagagg
 45cgggaatgactaaataagacgagaagaccctatggagcttTAATTAACTG
 46ATTCACAAAAAACAACACACAAACCTTAACCTTCAGGGACAACAAAACTT
 47TTGATTGAATCAGCAATTTCGGTTGGGGTGACCTCGGAGAACAAAACAAC
 48CTCCGAGTGATTTAAATCCAGACTAACCAGTCAAAATATATAATCACTTA
 49TTGATCCAAACCATTGATCAACGGAACAAGTTACCCTAGGGATAACAGCG
 50CAATCCTATTCCAGAGTCCATATCGACAATTAGGGTTTACGACCTCGATG
 51TTGGATCAAGACATCCTAATGGTGCAACCGCTATTAAGGGTTCGTTTGTT
 52CAACGATTAAAGTCTTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGT
 53CGGTTTCTATCTATTCTATACTTTTCCCAGTACGAAAGGACAAGAAAAGT
 54AGGGCCCACTTTACAAGAAGCGCCCTCAAACTAATAGATGACATAATCTA
 55AATCTAACTAATTTATAACTTCTACCGCCCTAGAACAGGGCTCgttaggg
 56tggcagagcccggaaattgcataaaacttaaacctttacactcagaggtt
 57caactcctctccctaacaacaTGTTCATAATTAACGTCCTCCTCCTAATT
 58GTCCCAATCTTGCTCGCCGTAGCATTCCTCACACTAGTTGAACGAAAAGT
 59CTTAGGCTATATGCAACTTCGCAAAGGACCCAACATCGTAGGCCCCTATG
 60GCCTACTACAACCTATTGCCGATGCCCTCAAACTATTTATCAAAGAGCCA
 61CTACAACCACTAACATCATCGACATCCATATTCATCATCGCACCAATCCT
 62AGCCCTAACCCTGGCCTTAACCATATGAATCCCTCTGCCCATACCATACC
 63CACTAATCAACATAAACCTAGGAATTCTATTCATACTAGCCATGTCCAGC
 64CTAGCTGTCTACTCAATCCTTTGATCAGGATGGGCCTCAAACTCAAAATA
 65CGCCCTAATTGGAGCTCTACGAGCAGTAGCACAAACCATCTCATACGAAG
 66TAACTCTAGCAATCATCCTACTCTCAGTCCTCCTAATAAGCGGATCATTC
 67ACATTATCAACACTTATTATTACCCAAGAATACCTCTGATTAATCTTCCC
 68ATCATGACCCTTAGCCATAATGTGATTCATCTCAACATTAGCCGAAACCA
 69ACCGAGCTCCATTTGACCTAACAGAAGGAGAATCAGAACTCGTCTCTGGA
 70TTCAACGTTGAATACGCAGCCGGCCCATTTGCTCTATTCTTCCTAGCAGA
 71ATACGCAAACATCATCATGATAAACATCTTCACAACAACCCTATTTCTAG
 72GAGCATTTCACAACCCCTACCTGCCAGAACTCTACTCAATTAATTTCACC
 73ATTAAAGCTCTCCTTCTAACATGTTCCTTCCTATGAATCCGAGCATCCTA
 74CCCACGATTCCGATATGACCAACTTATACACCTCCTATGAAAGAACTTCC
 75TACCACTCACACTAGCCCTCTGCATATGACACGTCTCACTTCCAATCATA
 76CTATCCAGCATCCCACCACAAACATAGGAAATATGTCTGACAAAAGAGTT
 77ACTTTGATAGAGTAAAACATAGAGGCTCAAACCCTCTTATTTctagaact
 78acaggaattgaacctgctcctgagaattcaaaatcctccgtgctaccgaa
 79ttacaccatgtcctaCAAGTAAGGTCAGCTAAATAAGCTATCGGGCCCAT
 80ACCCCGAAAATGTTGGATTACACCCTTCCCGTACTAATAAATCCCCTTAT
 81CTTCACAACTATTCTAATAACAGTTCTTCTAGGAACTATAATCGTTATAA
 82TAAGCTCACACTGACTAATAATCTGAATCGGATTTGAAATAAATCTACTA
 83GCCATTATCCCTATCCTAATAAAAAAGTACAATCCCCGAACCATAGAAGC
 84CTCCACCAAATATTTTCTAACCCAAGCCACCGCATCAATACTCCTCATAA
 85TAGCGATCATCATTAACCTCATACACTCAGGCCAATGAACAATCACAAAA
 86GTCTTCAACCCCACAGCGTCCATCATTATAACTTCAGCTCTCGCCATAAA
 87ACTTGGACTCACACCATTCCACTTCTGAGTACCCGAAGTCACACAGGGCA
 88TCTCATTAACATCAGGTCTCATCCTACTTACATGACAAAAACTAGCCCCA
 89ATATCAATCCTATATCAAATCTCACCCTCAATTAACCTAAATATCTTATT
 90AACTATAGCCGTACTGTCAATCCTAGTAGGAGGCTGAGGCGGTCTCAACC
 91AAACCCAACTACGAAAAATCATAGCATACTCGTCAATCGCGCATATAGGA
 92TGAATAACAGCTGTCCTAGTATATAACCCAACACTAACAATACTAAACAT
 93ATTAATTTACATTATAATAACACTCACAATATTCATACTATTTATCCACA
 94GCTCCTCTACTACAACACTATCACTCTCCCACACATGAAACAAAATACCT
 95CTAACCACTACACTAATCTTAATTACCTTACTATCCATAGGAGGCCTCCC
 96CCCACTATCAGGATTCATACCCAAATGAATAATCATTCAAGAGCTCACCA
 97AAAATAGCAGCATCATCCTCCCCACACTAATAGCCATTATAGCACTACTC
 98AACCTCTACTTCTACATACGACTAACCTATTCCACCTCACTGACCATATT
 99CCCATCCACAAACAACATAAAAATAAAATGACAATTCGAAACCAAACGAA
100TTACTCTCTTACCCCCGTTAATTGTTATATCCTCCCTACTCCTCCCCCTA
101ACCCCCATACTATCAATTTTGGACTAGGAATTTAGGTTAACATCCCAGAC
102CAAGAGCCTTCAAAGCTCTAAGCAAGTGAATCCACTTAATTCCTGCATAC
103TAAGGACTGCGAGACTCTATCTCACATCAATTGAACGCAAATCAAACTCT
104TTTATTAAGCTAAGCCCTTACTAGATTGGTGGGCTACCATCCCACGAAAT
105TTTAGTTAACAGCTAAATACCCTAATCAACTGGCTTCAATCTACTTCTCC
106CGCCGCCTAGAAAAAAAGGCGGGAGAAGCCCCGGCAGAAATTGAAGCTGC
107TCCTTTGAATTTGCAATTCAATGTGAAAATTCACCACGGGACTTGATAAG
108AAGAGGATTCCAACCCCTGTCTTTAGATTTACAGTCTAATGCTTACTCAG
109CCATCTTACCTATGTTCATCAACCGCTGACTATTTTCAACTAACCACAAA
110GACATCGGCACTCTGTACCTCCTATTCGGCGCTTGAGCTGGAATAGTAGG
111AACTGCCCTAAGCCTCCTAATCCGTGCTGAATTAGGCCAACCTGGGACCC
112TACTAGGAGATGATCAGATCTACAATGTCATTGTAACCGCCCATGCATTC
113GTAATAATTTTCTTTATGGTCATACCCATTATAATCGGAGGATTCGGAAA
114CTGATTAGTCCCCCTGATAATTGGAGCACCTGATATAGCTTTCCCCCGAA
115TAAACAACATAAGCTTCTGATTACTTCCCCCATCATTCCTACTTCTTCTC
116GCTTCCTCAATAATTGAAGCAGGTGCCGGAACAGGCTGAACCGTATATCC
117TCCTCTAGCTGGAAATCTGGCGCATGCAGGAGCCTCTGTTGACTTAACCA
118TTTTCTCTCTCCACCTAGCTGGGGTGTCCTCGATTTTAGGTGCCATCAAC
119TTTATTACCACAATCATTAACATAAAACCACCAGCCCTATCCCAATATCA
120AACCCCCCTATTCGTTTGATCTGTCCTTATTACGGCAGTACTCCTTCTCC
121TAGCCCTCCCGGTCCTAGCAGCAGGCATTACCATGCTTCTCACAGACCGT
122AACCTGAACACTACTTTCTTCGACCCCGCAGGAGGAGGGGATCCAATCCT
123TTATCAACACCTATTCTGATTCTTCGGACACCCCGAAGTCTATATTCTTA
124TCCTACCAGGCTTCGGTATAATCTCACACATCGTCACATACTACTCAGGT
125AAAAAGGAACCTTTTGGCTACATGGGTATAGTGTGAGCTATAATATCCAT
126TGGCTTTCTAGGCTTCATCGTATGGGCTCACCACATGTTTACAGTAGGGA
127TAGACGTTGACACACGAGCATACTTCACATCAGCTACCATAATCATCGCT
128ATCCCTACTGGTGTAAAAGTATTCAGCTGACTAGCCACCCTGCACGGAGG
129AAATATCAAATGATCTCCAGCTATACTCTGAGCTCTAGGCTTCATCTTCT
130TATTCACAGTAGGAGGTCTAACAGGAATCGTCCTAGCTAACTCATCCCTA
131GATATTGTTCTCCACGATACTTATTATGTAGTAGCACATTTCCATTATGT
132CCTGTCTATAGGAGCAGTCTTCGCCATTATGGGGGGATTTGTACACTGAT
133TCCCTCTATTCTCAGGATACACACTCAACCAAACCTGAGCAAAAATCCAC
134TTTACAATTATATTCGTAGGGGTAAATATAACCTTCTTCCCACAACATTT
135CCTTGGCCTCTCAGGAATGCCACGACGCTATTCTGATTATCCAGACGCAT
136ATACAACATGAAATACCATCTCATCCATAGGATCTTTTATCTCACTTACA
137GCAGTGATACTAATAATTTTCATAATTTGAGAAGCGTTCGCATCCAAACG
138AGAAGTGTCTACAGTAGAATTAACCTCAACTAATCTGGAATGACTACACG
139GATGCCCCCCACCATACCACACATTTGAAGAACCCACCTACGTAAACCTA
140AAAtaagaaaggaaggaatcgaaccccctctaactggtttcaagccaata
141tcataaccactatgtctttctcCATCAATTGAGGTATTAGTAAAAATTAC
142ATGACTTTGTCAAAGTTAAATTATAGGTTAAACCCCTATATACCTCTATG
143GCCTACCCCTTCCAACTAGGATTCCAAGACGCAACATCCCCTATTATAGA
144AGAACTCCTACACTTCCACGACCACACACTAATAATCGTATTCCTAATTA
145GCTCTCTAGTATTATATATTATCTCATCAATACTAACAACTAAATTAACC
146CATACCAGCACCATAGATGCTCAAGAAGTAGAGACAATTTGAACGATTTT
147ACCAGCCATCATCCTTATTCTAATCGCCCTCCCATCCCTACGAATTCTAT
148ATATAATAGATGAAATCAATAATCCGTCCCTCACAGTCAAAACAATAGGC
149CACCAATGATACTGAAGCTACGAGTATACCGATTACGAAGACTTGACCTT
150TGACTCCTACATGATCCCCACATCAGACCTAAAACCAGGAGAATTACGTC
151TTCTAGAAGTCGACAATCGAGTGGTTCTCCCCATAGAAATAACCATCCGA
152ATGCTAATTTCATCCGAAGACGTCCTACACTCATGAGCTGTGCCCTCCCT
153AGGCCTAAAAACAGACGCTATCCCTGGGCGCCTAAATCAGACAACTCTCG
154TGGCCTCTCGACCAGGACTTTACTACGGTCAATGCTCAGAGATCTGCGGA
155TCAAACCACAGCTTTATACCAATTGTCCTTGAACTAGTTCCACTGAAACA
156CTTCGAAGAATGATCTGCATCAATATTATAAAGTCACTAAGAAGCTATTA
157TAGCATTAACCTTTTAAGTTAAAGATTGAGGGTTCAACCCCCTCCCTAGT
158GATATGCCACAGTTGGATACATCAACATGATTTATTAATATCGTCTCAAT
159AATCCTAACTCTATTTATTGTATTTCAACTAAAAATCTCAAAGCACTCCT
160ATCCGACACACCCAGAAGTAAAGACAACCAAAATAACAAAACACTCTGCC
161CCTTGAGAATCAAAATGAACGAAAATCTATTCGCCTCTTTCGCTACCCCA
162ACAATAGTAGGCCTCCCTATTGTAATTCTGATCATCATATTTCCCAGCAT
163CCTATTCCCCTCACCCAACCGACTAATCAACAATCGCCTAATCTCAATTC
164AACAATGGCTAGTCCAACTTACATCAAAACAAATAATAGCTATCCATAAC
165AGCAAAGGACAAACCTGAACTCTTATACTCATATCACTGATCCTATTCAT
166TGGCTCAACAAACTTATTAGGCCTACTACCTCACTCATTTACACCAACAA
167CACAACTATCAATAAACCTAGGCATAGCTATTCCCCTATGGGCAGGGACA
168GTATTCATAGGCTTTCGTCACAAAACAAAAGCAGCCCTAGCCCACTTTCT
169ACCTCAAGGGACGCCCATTTTCCTCATCCCCATACTAGTAATTATCGAGA
170CTATCAGCCTATTTATTCAACCTGTAGCCCTAGCCGTGCGGCTAACCGCT
171AACATTACCGCCGGACACCTCCTAATACACCTCATCGGAGGGGCAACACT
172AGCCCTCATAAGCATCAGCCCCTCAACAGCCCTTATTACGTTTATCATCC
173TAATTCTACTAACTATCCTCGAATTCGCAGTAGCTATAATCCAAGCCTAC
174GTATTCACTCTCCTGGTAAGCCTTTACTTACACGACAACACCTAATGACC
175CACCAAACCCACGCTTACCACATAGTAAACCCCAGCCCATGACCACTTAC
176AGGAGCCCTATCAGCCCTCCTGATAACATCAGGACTAGCCATGTGATTTC
177ACTTTAACTCAACCTTACTTCTAGCTATAGGGCTATTAACTAACATCCTT
178ACCATATATCAATGATGACGAGACATCATCCGAGAAAGCACATTCCAAGG
179CCATCACACATCAATCGTTCAAAAGGGACTCCGATATGGCATAATCCTTT
180TTATTATCTCAGAAGTCTTCTTCTTCTCTGGCTTCTTCTGAGCCTTTTAC
181CACTCAAGCCTAGCCCCCACACCCGAACTAGGCGGCTGCTGACCACCCAC
182AGGTATCCACCCCTTAAACCCCCTAGAAGTCCCCTTACTCAACACCTCAG
183TGCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCACCATAGCCTAATA
184GAAGGAAACCGTAAAAATATGCTCCAAGGCCTATTCATCACAATTTCACT
185AGGCGTATACTTCACCCTTCTCCAAGCCTCAGAATACTATGAAGCCTCAT
186TTACTATTTCAGATGGAGTATACGGATCAACATTTTTCGTAGCAACAGGG
187TTCCACGGACTACACGTAATTATCGGATCTACCTTCCTCATTGTATGTTT
188CCTACGCCAACTAAAATTCCACTTTACATCCAGCCACCACTTCGGATTCG
189AAGCAGCCGCTTGATACTGACACTTCGTCGACGTAGTCTGACTATTCTTG
190TACGTCTCTATTTATTGATGAGGATCCTATTCTTTTAGTATTGACCAGTA
191CAATTGACTTCCAATCAATCAGCTTCGGTATAACCCGAAAAAGAATAATA
192AACCTCATACTGACACTCCTCACTAACACATTACTAGCCTCGCTACTCGT
193ACTCATCGCATTCTGACTACCACAACTAAACATCTATGCAGAAAAAACCA
194GCCCATATGAATGCGGATTTGACCCTATAGGGTCAGCACGCCTCCCCTTC
195TCAATAAAATTTTTCTTAGTGGCCATTACATTTCTGCTATTCGACTTAGA
196AATTGCCCTCCTATTACCCCTTCCATGAGCATCCCAAACAACTAACCTAA
197ACACTATACTTATCATAGCACTAGTCCTAATCTCTCTTCTAGCCATCAGC
198CTAGCCTACGAATGAACCCAAAAAGGACTAGAATGAACTGAGTATGGTAA
199TTAGTTTAAACCAAAACAAATGATTTCGACTCATTAAACTATGATTAACT
200TCATAATTACCAACATGTCACTAGTCCATATTAATATCTTCCTAGCATTC
201ACAGTATCCCTCGTAGGCCTACTAATGTACCGATCCCACCTAATATCCTC
202ACTCCTATGCCTAGAAGGAATAATACTATCACTATTCGTCATAGCAACCA
203TAATAGTCCTAAACACCCACTTCACACTAGCTAGTATAATACCTATCATC
204TTACTAGTATTTGCTGCCTGCGAACGAGCTCTAGGATTATCCCTACTAGT
205CATAGTCTCCAATACTTATGGAGTAGACCACGTACAAAACCTTAACCTCC
206TCCAATGCTAAAAATTATCATTCCCACAATCATACTTATGCCCCTTACAT
207GACTATCAAAAAAGAATATAATCTGAATCAACACTACAACCTATAGTCTA
208TTAATCAGCCTTATCAGCCTATCCCTCCTAAACCAACCTAGCAACAATAG
209CCTAAACTTCTCACTAATATTCTTCTCCGATCCCCTATCAGCCCCACTTC
210TGGTGTTGACAACATGACTACTGCCACTAATACTCATAGCCAGCCAACAC
211CATCTATCTAAGGAACCACTAATCCGAAAAAAACTCTACATCACCATGCT
212AACCATACTTCAAACTTTCCTAATCATGACTTTTACCGCCACAGAACTAA
213TCTCCTTCTACATCCTATTTGAAGCCACATTAGTTCCAACACTAATTATC
214ATCACCCGCTGAGGCAACCAAACAGAACGCCTGAACGCAGGCCTCTACTT
215CCTATTCTACACACTAATAGGTTCCCTCCCACTCTTAGTTGCACTAATCT
216CTATCCAAAACCTAACAGGCTCACTAAACTTCCTATTAATTCAATACTGA
217AACCAAGCACTACCCGACTCTTGATCCAATATTTTCCTATGACTAGCATG
218TATAATAGCATTCATAGTCAAAATACCGGTATATGGTCTTCACCTCTGAC
219TCCCAAAAGCCCATGTAGAAGCCCCAATTGCCGGATCCATAGTGCTAGCA
220GCCATTCTACTAAAACTAGGAGGCTACGGAATACTACGAATTACAACAAT
221ACTAAACCCCCAAACTAGCTTTATAGCCTACCCCTTCCTCATACTATCCC
222TGTGAGGAATAATCATAACTAGTTCCATCTGCTTGCGACAAACCGATCTA
223AAATCACTTATTGCATACTCCTCTGTCAGCCACATAGCCCTAGTAATCGT
224AGCCGTCCTCATCCAAACACCATGAAGTTATATAGGAGCTACAGCCCTAA
225TAATCGCTCACGGCCTTACATCATCAATACTATTCTGCCTGGCAAACTCA
226AATTACGAACGTACCCATAGCCGAACTATAATCCTAGCCCGCGGGCTTCA
227AACACTTCTTCCCCTTATAGCAGCCTGATGACTATTAGCCAGCCTAACCA
228ACCTGGCCCTCCCTCCCAGCATTAACCTAATTGGAGAGCTATTCGTAGTA
229ATATCATCATTCTCATGATCAAATATTACCATTATCCTAATAGGAGCCAA
230TATCACCATCACCGCCCTCTACTCCCTATACATACTAATCACAACACAAC
231GAGGGAAATACACACACCATATCAACAGCATTAAACCTTCATTTACACGA
232GAAAACGCACTCATGGCCCTCCACATGACTCCCCTACTACTCCTATCACT
233TAACCCTAAAATTATCCTAGGCTTTACGTACTGTAAATATAGTTTAACAA
234AAACACTAGATTGTGGATCTAGAAACAGAAACTTAATATTTCTTATTTAC
235CGAGAAAGTATGCAAGAACTGCTAATTCATGCCCCCATGTCCAACAAACA
236TGGCTCTCTCAAACTTTTAAAGGATAGGAGCTATCCGTTGGTCTTAGGAA
237CCAAAAAATTGGTGCAACTCCAAATAAAAGTAATCAACATGTTCTCCTCC
238CTCATACTAGTTTCACTATTAGTACTAACCCTCCCAATCATATTATCAAT
239CTTCAATACCTACAAAAACAGCACGTTCCCGCATCATGTAAAAAACACTA
240TCTCATATGCCTTCATTACTAGCCTAATTCCCACTATAATATTTATTCAC
241TCTGGACAAGAAACAATTATCTCAAACTGACACTGAATAACCATACAAAC
242CCTCAAACTATCCCTAAGCTTCAAACTAGATTACTTCTCAATAATTTTCG
243TACCAGTAGCCCTATTCGTAACATGATCTATTATGGAATTCTCCCTATGA
244TACATGCACTCAGATCCTTACATTACTCGATTTTTTAAATACTTACTTAC
245ATTCCTCATCACTATAATAATTCTAGTCACAGCTAACAACCTTTTCCAAC
246TGTTCATCGGATGGGAGGGAGTAGGCATCATGTCATTCTTACTAATCGGA
247TGATGATACGGCCGAACAGATGCCAACACCGCGGCCCTTCAAGCAATCCT
248TTATAACCGCATCGGGGATATCGGCTTCATCATGGCCATAGCCTGATTCC
249TATTCAACACCAACACATGAGACCTCCAACAAATCTTCATACTCGACCCC
250AACCTTACCAACCTCCCGCTCCTAGGCCTCCTCCTAGCCGCAACTGGCAA
251ATCCGCTCAATTTGGACTCCACCCATGACTTCCTTCAGCCATAGAGGGCC
252CTACACCAGTCTCAGCCCTACTCCACTCCAGCACAATAGTTGTAGCAGGC
253GTCTTCCTGCTAATCCGCTTCCATCCACTAATAGAAAACAACAAAACAAT
254CCAGTCACTTACCCTATGCCTAGGAGCCATCACCACACTATTCACAGCAA
255TCTGCGCACTCACTCAAAACGATATCAAAAAAATCATTGCTTTCTCCACC
256TCCAGCCAACTAGGCCTGATAATCGTAACCATCGGTATCAATCAACCCTA
257CCTAGCATTCCTCCACATTTGCACTCACGCATTCTTCAAAGCTATACTAT
258TTATATGTTCCGGATCCATTATCCACAGCCTAAATGACGAGCAAGATATC
259CGAAAAATAGGCGGACTATTTAATGCAATACCCTTCACCACCACATCTCT
260AATTATTGGCAGCCTTGCACTCACCGGAATTCCTTTCCTCACAGGCTTCT
261ACTCCAAAGACCTCATCATCGAAACCGCCAACACATCGTACACCAACGCC
262TGAGCCCTACTAATAACTCTCATTGCCACATCCCTCACAGCTGTCTACAG
263TACCCGAATCATCTTCTTTGCACTCCTAGGGCAACCCCGCTTCCTCCCTC
264TGACCTCAATCAACGAAAATAACCCCTTTCTAATTAACTCCATCAAACGC
265CTCTTAATTGGCAGCATTTTTGCCGGATTCTTCATCTCCAACAATATCTA
266CCCCACAACCGTCCCAGAAATAACCATACCTACTTACATAAAACTCACCG
267CCCTCGCAGTAACCATCCTAGGATTTACACTAGCCCTAGAACTAAGCTTG
268ATAACCCATAACTTAAAACTAGAACACTCCACCAACGTATTCAAATTCTC
269CAACCTCCTAGGATACTACCCAACAATTATACACCGACTCCCACCGCTCG
270CTAACCTATCAATAAGCCAAAAATCAGCATCACTTCTACTAGACTCAATC
271TGACTAGAAAACATCCTGCCAAAATCTATCTCCCAGTTCCAAATAAAAAC
272CTCGATCCTAATTTCCACCCAAAAAGGACAAATCAAATTATATTTCCTCT
273CATTCCTCATCACCCTTACCCTAAGCATACTACTTTTTAATCTCCACGAG
274TAACCTCTAAAATTACCAAGACCCCAACAAGCAACGATCAACCAGTCACA
275ATCACAACCCAAGCCCCATAACTATACAATGCAGCAGCCCCTATAATTTC
276CTCACTAAACGCCCCAGAATCTCCAGTATCATAAATAGCTCAAGCCCCCA
277CACCACTAAACTTAAACACTACCCCCACTTCCTCACTCTTCAGAACATAT
278AAAACCAACATAACCTCCATCAACAACCCTAAAAGAAATACCCCCATAAC
279AGTCGTATTAGACACCCATACCTCAGGATACTGCTCAGTAGCCATAGCCG
280TTGTATAACCAAAAACAACCAACATTCCTCCCAAATAAATCAAAAACACC
281ATCAACCCCAAAAAGGACCCTCCAAAATTCATAATAATACCACAACCTAC
282CCCTCCACTTACAATCAGCACTAAACCCCCATAAATAGGTGAAGGTTTTG
283AAGAAAACCCCACAAAACTAACAACAAAAATAACACTCAAAATAAACACA
284ATATATGTCATCATTATTCCCACGTGGAATCTAACCACGACCAATGACAT
285GAAAAATCATCGTTGTATTTCAACTATAAGAACACCAATGACAAACATCC
286GGAAATCTCACCCACTAATTAAAATCATCAATCACTCTTTTATTGACCTA
287CCAGCCCCCTCAAACATTTCATCATGATGAAACTTCGGCTCCCTCCTAGG
288AATCTGCCTAATCCTCCAAATCTTAACAGGCCTATTCCTAGCCATACACT
289ACACATCAGACACGACAACTGCCTTCTCATCCGTCACTCACATCTGCCGA
290GACGTTAACTACGGATGAATTATTCGCTACCTCCATGCCAACGGAGCATC
291AATATTTTTTATCTGCCTCTTCATTCACGTAGGACGCGGCCTCTACTACG
292GCTCTTACACATTCCTAGAGACATGAAACATTGGAATCATCCTACTTTTC
293ACAGTTATAGCTACAGCATTCATGGGCTATGTCCTACCATGAGGCCAAAT
294ATCCTTTTGAGGAGCAACAGTCATCACGAACCTCCTATCAGCAATTCCCT
295ACATCGGTACTACCCTCGTCGAGTGAATCTGAGGTGGATTCTCAGTAGAC
296AAAGCCACCCTTACCCGATTTTTTGCTTTCCACTTCATCCTACCCTTCAT
297CATCACAGCCCTGGTAGTCGTACATTTACTATTTCTTCACGAAACAGGAT
298CTAATAACCCCTCAGGAATCCCATCCGATATGGACAAAATCCCATTCCAC
299CCATATTATACAATTAAAGACATCCTAGGACTCCTCCTCCTGATCTTGCT
300CCTACTAACTCTAGTATTATTCTCCCCCGACCTCCTAGGAGACCCAGACA
301ACTACACCCCAGCTAACCCTCTCAGCACTCCCCCTCATATTAAACCAGAA
302TGGTACTTCCTGTTTGCCTACGCCATCCTACGCTCCATTCCCAACAAACT
303AGGCGGCGTATTAGCCCTAATCCTCTCCATCCTGATCCTAGCACTCATCC
304CCACCCTCCACATATCAAAACAACGAAGCATAATATTCCGGCCTCTCAGC
305CAATGCGTATTCTGACTCTTAGTGGCAGACTTACTGACACTAACATGAAT
306CGGCGGACAGCCAGTGGAACACCCATACGTAATTATCGGCCAACTGGCCT
307CAATCCTCTACTTCTCCCTAATTCTCATTTTTATACCACTCGCAAGCACC
308ATCGAAAACAATCTTCTAAAATGAAGAGTCCCTGTAGTATATCGCACATT
309ACCCTGGTCTTGTAAACCAGAAAAGGGGGAAAACGTTTCCTCCCAAGGAC
310TATCAAGGAAGAAGCTCTAGCTCCACCATCAACACCCAAAGCTGAAATTC
311TACTTAAACTATTCCTTGATTTCTTCCCCTAAACGACAACAATTTACCCT
312CATGTGCTATGTCAGTATCAGATTATACCCCCACATAACACCATACCCAC
313CTGACATGCAATATCTTATGAATGGCCTATGTACGTCGTGCATTAAATTG
314TCTGCCCCATGAATAATAAGCATGTACATAATATCATTTATCTTACATAA
315GTACATTATATTATTGATCGTGCATACCCCATCCAAGTCAAATCATTTCC
316AGTCAACACGCATATCACAGCCCATGTTCCACGAGCTTAATCACCAAGCC
317GCGGGAAATCAGCAACCCTCCCAACTACGTGTCCCAATCCTCGCTCCGGG
318CCCATCCAAACGTGGGGGTTTCTACAATGAAACTATACCTGGCATCTGGT
319TCTTTCTTCAGGGCCATTCCCACCCAACCTCGCCCATTCTTTCCCCTTAA
320ATAAGACATCTCGATGGACTAATGACTAATCAGCCCATGCTCACACATAA
321CTGTGATTTCATGCATTTGGTATCTTTTTATATTTGGGGATGCTATGACT
322CAGCTATGGCCGTCAAAGGCCTCGACGCAGTCAATTAAATTGAAGCTGGA
323CTTAAATTGAACGTTATTCCTCCGCATCAGCAACCATAAGGTGTTATTCA
324GTCCATGGTAGCGGGACATAGGAAACAAgtgcacctgtgcacctgtgcac
325ctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacct
326gtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgt
327gcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgc
328acctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgcac
329ctgtgcacctACCCGCGCAGTAAGCAAGTAATATAGCTTTCTTAATCAAA
330CCCCCCCTACCCCCCATTAAACTCCACATATGTACATTCAACACAATCTT
331GCCAAACCCCAAAAACAAGACTAAACAATGCACAATACTTCATGAAGCTT
332AACCCTCGCATGCCAACCATAATAACTCAACACACCTAACAATCTTAACA
333GAACTTTCCCCCCGCCATTAATACCAACATGCTACTTTAATCAATAAAAT
334TTCCATAGACAGGCATCCCCCTAGATCTAATTTTCTAAATCTGTCAACCC
335TTCTTCCCCC