PageRenderTime 37ms CodeModel.GetById 30ms app.highlight 4ms RepoModel.GetById 1ms app.codeStats 0ms

/test-data/picard_output_AsMetrics_indexed_hg18_sorted_pair.html

https://bitbucket.org/cistrome/cistrome-harvard/
HTML | 34 lines | 31 code | 3 blank | 0 comment | 0 complexity | a3f8f75ef06e069d20a3e417ed34c14e MD5 | raw file
 1<style type="text/css">
 2        tr.d0 td {background-color: oldlace; color: black;}
 3        tr.d1 td {background-color: aliceblue; color: black;}
 4        </style><?xml version="1.0" encoding="utf-8" ?>
 5<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
 6<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
 7<head>
 8<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
 9<meta name="generator" content="Galaxy CollectAlignmentSummaryMetrics tool output - see http://getgalaxy.org/" />
10<title></title>
11<link rel="stylesheet" href="/static/style/base.css" type="text/css" />
12</head>
13<body>
14<div class="document">
15Galaxy tool wrapper picard_wrapper at 09/05/2011 11:03:57</b><br/><b>The following output files were created (click the filename to view/download a copy):</b><hr/><table>
16<tr><td><a href="CollectAlignmentSummaryMetrics.log">CollectAlignmentSummaryMetrics.log</a></td></tr>
17</table><p/>
18<b>Picard log</b><hr/>
19<pre>## executing java -Xmx2g -jar /udd/rerla/galaxy-central/tool-data/shared/jars/CollectAlignmentSummaryMetrics.jar VALIDATION_STRINGENCY=LENIENT ASSUME_SORTED=true  ADAPTER_SEQUENCE= IS_BISULFITE_SEQUENCED=false MAX_INSERT_SIZE=100000 OUTPUT=/udd/rerla/galaxy-central/database/job_working_directory/5/dataset_5_files/CollectAlignmentSummaryMetrics.metrics.txt R=/udd/rerla/galaxy-central/database/job_working_directory/5/dataset_5_files/hg19.fasta_fake.fasta TMP_DIR=/tmp INPUT=/export/tmp/tmpBrCiH5/database/files/000/dataset_4.dat returned status 1 and stderr: 
20[Mon May 09 11:03:51 EDT 2011] net.sf.picard.analysis.CollectAlignmentSummaryMetrics MAX_INSERT_SIZE=100000 ADAPTER_SEQUENCE=[AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG, IS_BISULFITE_SEQUENCED=false] INPUT=/export/tmp/tmpBrCiH5/database/files/000/dataset_4.dat OUTPUT=/udd/rerla/galaxy-central/database/job_working_directory/5/dataset_5_files/CollectAlignmentSummaryMetrics.metrics.txt REFERENCE_SEQUENCE=/udd/rerla/galaxy-central/database/job_working_directory/5/dataset_5_files/hg19.fasta_fake.fasta ASSUME_SORTED=true TMP_DIR=/tmp VALIDATION_STRINGENCY=LENIENT    IS_BISULFITE_SEQUENCED=false STOP_AFTER=0 VERBOSITY=INFO QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
21[Mon May 09 11:03:57 EDT 2011] net.sf.picard.analysis.CollectAlignmentSummaryMetrics done.
22Runtime.totalMemory()=912588800
23Exception in thread "main" net.sf.picard.PicardException: Requesting earlier reference sequence: 0 < 1
24	at net.sf.picard.reference.ReferenceSequenceFileWalker.get(ReferenceSequenceFileWalker.java:78)
25	at net.sf.picard.analysis.SinglePassSamProgram.makeItSo(SinglePassSamProgram.java:115)
26	at net.sf.picard.analysis.SinglePassSamProgram.doWork(SinglePassSamProgram.java:54)
27	at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:157)
28	at net.sf.picard.cmdline.CommandLineProgram.instanceMainWithExit(CommandLineProgram.java:117)
29	at net.sf.picard.analysis.CollectAlignmentSummaryMetrics.main(CollectAlignmentSummaryMetrics.java:106)
30
31
32</pre><hr/>The freely available <a href="http://picard.sourceforge.net/command-line-overview.shtml">Picard software</a> 
33generated all outputs reported here running as a <a href="http://getgalaxy.org">Galaxy</a> tool</div></body></html>
34