PageRenderTime 71ms CodeModel.GetById 14ms app.highlight 15ms RepoModel.GetById 1ms app.codeStats 1ms

/test-data/lastz_paired_input2.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 703 lines | 703 code | 0 blank | 0 comment | 0 complexity | 595a37ecd6f2542c6016f90c4e70b040 MD5 | raw file
  1>F2YP0BU02IPIOC length=313 xy=3454_0058 region=2 run=R_2009_09_24_17_10_49_
  2TTTTTCCTCACAAGCATCACCATTCTGACCTTTATTATGATAGATTTATTTTGTCAGTTC
  3TTAAATATCCTATAAAGAGAATAATACAGCATGCACTCTTTTTGTCTAGCCTCTGTGCTC
  4AGTGTAATGTCTATGGGAGTCATCCACGTTAAGTATGGCAATAGCTCATTCTTTTCCATT
  5GCTGCATAGTATTCCATTCTATCAGTCTATCATGTTTTATTTATCCATTTTCCTGCTGCA
  6GATCATTTGGGATCATTTCCAGCTTTTGGCAATTATGAAAAATCGTATAACTTCGTATAA
  7TGTATGCTATACG
  8>F2YP0BU02GASSR length=219 xy=2466_0953 region=2 run=R_2009_09_24_17_10_49_
  9TAATGAATAAGCATGAAGACAAGATTAGAGAAGAATGAAGGAATGAACAAGCCTCCAAGA
 10ATATGGCACTATGTGAAAGACCAATCTATGTTTGATTGGTATACTTCGAAAGTGATGAGG
 11AGAATGGAACCAAGTTGGAAACACTCTTCAGCGTAATAACTTCGTATAGCATACATTATA
 12CGAAGTTATACGAATCATTGTTGTCTCTCCTGGTGGCAG
 13>F2YP0BU02HLXG3 length=220 xy=3003_0293 region=2 run=R_2009_09_24_17_10_49_
 14TTCATTTCCTTTGCTGCTTTCCCTTCATCTCCTCAATCCACAAACCGTAATAACTTCGTA
 15TAGCATACATTATACGAAGTTATACGATCCAATTTCCTAACTTCTAAAATGAGAATTAAT
 16CCTAATGCACTGCTCACTTCCCAGCAAGGGACATTCACTTTTCCACAAGAGCTCTCTTTA
 17CAAAGCAATTCAACAGCTAAGGCAATGAAGTCAGTCAGTA
 18>F2YP0BU02GF6D7 length=134 xy=2527_1997 region=2 run=R_2009_09_24_17_10_49_
 19GAGAAGCATCAAATTCAACTCCATATCTGAAGTCAAGCCGTAATAACTTCGTATAGCATA
 20CATTATACGAAGTTATACGAGAATTTGTGGTTCCTAGTTCTCAGTGTAATACTCCTTCCA
 21ATATATATGATAGG
 22>F2YP0BU02G6NFT length=92 xy=2829_0151 region=2 run=R_2009_09_24_17_10_49_
 23TCTTCTCTCTGCCATTCTGCCAGGCTCAGTCGTATAACTTCGTATAATGTATGCTATACG
 24AAGTTATTACGTATATATATGTGTGTATATAT
 25>F2YP0BU02GD65M length=129 xy=2504_3880 region=2 run=R_2009_09_24_17_10_49_
 26TTTAATTGGTTGTCTGGCTTTCTTATTGATGTGTCGTAATAACTTCGTATAGCATACATT
 27ATACGAAGTTATACGAACAAAACAATAAAGAGATTATAATGGAGCTGAAAATTACCTATT
 28GCCTAGTGA
 29>F2YP0BU02GW28F length=318 xy=2720_0525 region=2 run=R_2009_09_24_17_10_49_
 30GGTTTGAGCCACTGTGCCTGGCCAATTTTCTATTTTGTAGAGACAGGGTCTCACCATGTT
 31GCCCAGGTTACGTAATAACTTCGTATAGCATACATTATAAGAAGTTATACGACATGTCTG
 32CCGAAAGCTCAGTGGCAGGGCGGAGAGGGCCTGGGGCTGCCTCGTGAGGTGCGAGGGGTT
 33CTTGTGAAGGTGGGGAGGCCCAGGGTCAGGGCCTCCCAAGGTAATGCTGAAGGGGCTCTG
 34CTTCCAGAAGGGCCTGGACAACCTCAGAGGTCAGGGTGTTGAGCCAGGGGGCTCACCTTC
 35CTCTCCTGCCAAGGGGCT
 36>F2YP0BU02HKJIX length=388 xy=2987_1095 region=2 run=R_2009_09_24_17_10_49_
 37TTTTATTGTGACTTTTATAAATGGAGATCATTGGGTAAAACGTAATAACTTCGTATAGCA
 38TACATTATACGAAGTTATACGAACAAAGATAAGGAAATGGCAGGAGTGTTGCAGAAAGCA
 39GTGGTTTCTGAAGACACAGGTATAGGCAGATATGAAATACAGAGAAGAAATTTGAGCTGG
 40CGCTTCCAAATAACTGTACTTCTTTAGTGGTAAGATATCCCAAGCTTTGATTTCTCATCT
 41TATTCACTTTGTCAGGAAGAGACAAACAGGTGTGGGTGCTGGGCAGAGGGCTTGATCTCA
 42TTTTGCAGAGAAAGTGTTTGGAGACTTTGAACTAAGCAAAGAGTAACAGGGAAAATAAGA
 43TAAAAATGAAAAGGGTAATGATTCGGAG
 44>F2YP0BU02H80VC length=67 xy=3266_0534 region=2 run=R_2009_09_24_17_10_49_
 45CTATGTTGACTAGGCTGGTCTCGAACTCCTGGGCTCAAGCAGGCCTTGTGCCTCGGCCTC
 46CACCTAC
 47>F2YP0BU02IO6IM length=284 xy=3450_0684 region=2 run=R_2009_09_24_17_10_49_
 48TTGAACGGAATCGAATGGAATCATCATGGGATGGAAACGAATGGAATCATCATCGAATGG
 49CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGATGAATGGACTCGAATGGA
 50ATCAACATCAAACGGAATCAAGCGGAATTATCGAATGGAATTGAAGAGAATCATCGAGTG
 51GACTCGAATGGAATCATCTAATGGAATGGAATGGAATAATCTATGGACTCGAATGCAATC
 52ATCATCGAATGGAATCGAATGGAATCATCGAATGGACTCGAATG
 53>F2YP0BU02GU7ME length=113 xy=2698_3012 region=2 run=R_2009_09_24_17_10_49_
 54CCATATCGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGAGATATTCCAGTC
 55CGTCATTAAAATTAGATAATTTACGCCTAATAATTATATGTATGTATTGAAGC
 56>F2YP0BU02HYBDH length=366 xy=3144_0643 region=2 run=R_2009_09_24_17_10_49_
 57TTTTGTTATATTCAGGCCCGCAATGTATTGGATCGTATAACTTCGTATAATGTATGCTAT
 58ACGAAGTTATTACGTTTAATTCGATGTTGTCCATGAGTTTTGTTTTTCTATTTAGTTGCT
 59ATGTTTGTTTTAATGTAAGGCAAGATTAAAATATTACACTGTCACCGTTACTACCATCCT
 60CCCCAAATCCCCCTGTATTAGCTACCTAGGCTTGCTGGGTAACAAATTGTCACAAATTTA
 61TTAGCAAAAGAACACACACTTGCTATATCACTGCTCTGTAAGTCAGAAGCCCAGGTGGGC
 62TCGACTGGGTTCTGCACTTAAGGTCTCACAAGATTGAAATCAAGACATCAGCTGAGCTGG
 63GCTCTT
 64>F2YP0BU02GS94E length=98 xy=2676_3052 region=2 run=R_2009_09_24_17_10_49_
 65AGTCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGCAGGCACTGAGGAATG
 66GTGAGAGGCACTGGGAATGGTGAGGGCGACTGGGAAGT
 67>F2YP0BU02GFM2N length=339 xy=2521_1533 region=2 run=R_2009_09_24_17_10_49_
 68GGTTTAATTGCTCATTCAGTAGGTAGTAAACTGCAATTCAATCAAGCATGCTAAACCATT
 69GAAAATGAATGCATTACCAAGTATGAATAACTTGTTCATAATTCATTGAGCCGGCCATAG
 70GGCAGGCACAACTAAGAGGCATTTGGCAACCAAAGCAATGCAAGCTGGTTGTGAGGAGAA
 71AGAAGCTAGGATGCCTAAGAACAGATAGAAGAGCCTACCAGCCACTGACTCAGGTACAGA
 72GCTAGTCACTAAAGATGAATATTGGTCTGATGACTACCGTCCGTAATAACTTCGTATAGC
 73ATACATTATACGAAGTTATACGAGACATGAACAGAAATG
 74>F2YP0BU02H2R5T length=71 xy=3195_0127 region=2 run=R_2009_09_24_17_10_49_
 75GCAGCGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGAGCCTCATTCTCTTT
 76AAATGTAGACA
 77>F2YP0BU02IENAS length=319 xy=3330_0738 region=2 run=R_2009_09_24_17_10_49_
 78TTTGTATAAAGTGAGAGATAAGAATCCAGTCGTAATAACTTCGTATAGCATACATTATAC
 79GAGGTTATACGATATTCTGTATAGAGGTGATGGCTCATATAATTCAGCTGTGATAGCCAT
 80AATTTCCAAAATGACAGTAGGAAAATAATGTCTCATGGAGATAAAGGAAACTGACAATAA
 81AAATGGAAGAAGTACAAAAACTGCCATGTAAAATAATTCCTGGAAAATTTTTGAAAGTTT
 82TGCTGGAAAACTTTTTTGAAAGTTTTGCTGGAAAAGACTACATACTTCTCCAAAAGAAAA
 83GTAAACTTCTAAGTGTTAT
 84>F2YP0BU02HT2D7 length=41 xy=3095_3085 region=2 run=R_2009_09_24_17_10_49_
 85ATGGAGGAGTTGGGAGGACACTGTCTTGTAAGTCTGCAAGT
 86>F2YP0BU02H8REW length=269 xy=3263_0566 region=2 run=R_2009_09_24_17_10_49_
 87TTGACCCTTGACCTTTAGCTTCCTTCTTCCTTAACCAGCAAACCTCCATGCCCTATGTCT
 88CCTAAATGTCCTTCAAATCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGA
 89GAAAAGGTCTTTGTTACTCATGGCACAGAAAGAAGCATGAGCTTCATGTTTGCATCAGTT
 90CTTCTTGCTCTCCAAATCCCAAAGTAGGCAAGGTGGAGGTAGGCCAAGGTAAATTCTGTG
 91AATCCAGTGAGTTTATGACACAGCTGAGG
 92>F2YP0BU02IAR6Y length=369 xy=3286_0680 region=2 run=R_2009_09_24_17_10_49_
 93TTTTGCTGAGAAGCAAATGCCACACAATCAATAACTCGTAATAACTTCGTATAGCATACA
 94TTATACGAAGTTATACGATGAGAAAGGGAAAATGGCTCCTGAGAGTCCACCCTTGTGGAC
 95TGCTATACTTGTCTGGTAGGAAAATTAATTTCAGTTTCTATGAAGGCATTGAAGTTGTCA
 96ATATTTATTTCAATATTATTAATAATAATGATGTTCCGACATCCTGAATTCCAAGTTTCC
 97TGCCACTTAAACCAACTGGAAAACCACTGTTTTAGATGGCTTTTCTAAAAGCCCACCCCC
 98ATCAACAAGATACCCAAGATAGAGGGACTTACATGAAACATTCACTGAATGCTCCCAGAT
 99GGGTACAAG
100>F2YP0BU02I3TZY length=65 xy=3617_0268 region=2 run=R_2009_09_24_17_10_49_
101TGGAATGGAACGGAATGGAATGGAATGGAATCAACCCGAGTGCAGGGGAATGGAATGGAA
102TGGAA
103>F2YP0BU02JP6S8 length=265 xy=3871_2922 region=2 run=R_2009_09_24_17_10_49_
104TTTGATCCCTTTTCCCGCCATCTTCTATGGCAACTCTGGCATTTACACCTCACTTTATGT
105ACGCCATGGCTTTTTCCATACTTCGAGGAGCCATCGCAGTAATGAGTTCGTGTCATTTCC
106TGTGGTTTTCTCCAGGGTATTAAATCCTGTATTCTGGGAAAGCACTTTCAAATTGATTAA
107TTCTCCCATATTCAAGTTTATATTCCGTAATAACTTCGTATAGCATACATTATACGAAGT
108TATACGAAGTCATTGTGTGAACATT
109>F2YP0BU02IG2DL length=165 xy=3357_2999 region=2 run=R_2009_09_24_17_10_49_
110TTGTCATAATTTGTTACAGTAGTCACAGTAAGGTTATTCAATACTGTAATTACATTTAGA
111ATCAATAATAGTAATATATCCACAAACCACAAATATTGAAATTAATATGCCTCTAAATAT
112CGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGCCTA
113>F2YP0BU02I6OA8 length=121 xy=3649_1794 region=2 run=R_2009_09_24_17_10_49_
114TTGCAGATTGCACTGAGGATTAGAGACAACATAGAAGCGTAATAACTTCGTATAGCATAC
115ATTATACGAAGTTATACGATTGAGAGATGCCTGGGTGAATCACAGACGTGAGTGGTGGAC
116A
117>F2YP0BU02JHJNK length=351 xy=3773_1070 region=2 run=R_2009_09_24_17_10_49_
118TTTTTAAACCTGGAAAATACACCAAATTTCAATTAAAAATGAAAATGGAAAGATCAAACA
119AGACATAAATAGAATCAGAAAGAATAGGGTTCGTATAACTTCGTATAATGTATGCTATAC
120GAAGTTATTACGAGTAGAGTCTTTTATAAAAACATCGCAAGATGTGCGAGGAACTAAAAC
121ATACTAAGGGGGAAGGATTTTTAACTCGGCCCCAGCAAAAAGAACTCTGTGCCCCTCCAT
122GGCCCTGGATGGCGGATGAGAGAGGGGCTCGCCTGCTCACAGAGCCCTAAGGACGGCGCC
123TCCGTGGCTCGAGCTTGTCTAAAGGGACTTGGAAGGTGTCTGGTGAAAAGG
124>F2YP0BU02JWZQ1 length=307 xy=3949_0875 region=2 run=R_2009_09_24_17_10_49_
125GGTTGTGCTTGAATTGGACAGATCCAGTGAAACTAATCAAGTACCTACTATGTGCCAAGC
126ATTGTGTCAGATGCTCTCACATGCATTATCTTGGAATCGTATAACTTCGTATAATGTATG
127CTATACGAAGTTATTACGCAAGCGTGTATTAATGGTACTAATTTCTGTAGTGCTATGAAT
128AGAATCTTACTATTTTGTGTCTAGTCTTTTTGTTCAACATTTGCGTGTGAGATTCATCCA
129TGCTGTTGAACAAAGTTCCATGTCATTCATTTCCATCATTTTATAGTACATTGGGTGATT
130AAACCAC
131>F2YP0BU02G4WWP length=149 xy=2809_1031 region=2 run=R_2009_09_24_17_10_49_
132ATTAAGTGAATAGTGTCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGATA
133ATATCTACCATATTGAGCTATTTTAAGCAGTAAATGAATAAAATACGCAAAGTGCATAGC
134ACATGGTAGATAATAAAGGAAGCTATTTC
135>F2YP0BU02IDILN length=130 xy=3317_1241 region=2 run=R_2009_09_24_17_10_49_
136TTACATAGTTATAGTAATCAAACATTATGATGCTCACATAAAACAGATACATAGATCAAT
137GGAATATAATAGAATACCCAGAAATAAGCCTATGCATATACAGTCAACTAATTCTTGAAC
138AAGGCACACA
139>F2YP0BU02I80Y8 length=435 xy=3676_0930 region=2 run=R_2009_09_24_17_10_49_
140TTTTAGTAGAGATGGGGTTTCACCATGTTGGCCAGGCTGGTCTCGAACTCCTGGTCTCAA
141GTGATCCACCCACCTCGGACTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCTACTTC
142TTTCTTTAACCTTCAGCTCATGGATCCCCTACCCAGCAAGACTTCAGGGCCCTGATGGGT
143TAGATGCCCCACCTCTGCTCTTCCATAGTGTTCGTAATAACTTCGTATAGCATACATTAT
144ACGAAGTTATACGATAGAAAAGTGTGCCACCAAGAAAGACCTGCATTGGAAGGGCTAGAT
145GTGTGCTGCATATGCTGCATAGACCTTTACAGGGGAGTCTCTTTTCTCCTTCTTGCTTCC
146TTTGCACAGAATCACCATAGGATATCACAGGAGCTTGTGCAGTTGGACTGAGACCGCCAA
147GGCACACAGGGGATA
148>F2YP0BU02JWZ8I length=437 xy=3949_1504 region=2 run=R_2009_09_24_17_10_49_
149TTTTTGTCAAATAATAATTCTATTACCAGCTAAACTATCAATCATCGTATAACTTCGTAT
150AATGTATGCTATACGAAGTTATTACGTGCTAAAACATTCAGCACGCTCCTCCTCTCTGCA
151GCCCATAGCCCAGGTACCTTAGTGCAGGGTGGAGGAAGCCTTGGGCAACCTGCTCTGTGA
152TGAGCAACCTATTCTCCTAACAGCCCGAGCCTTCCACCGCCCTGAGGCCTTGAAGCACCT
153TGGGGATGGCCTTCCTGCCTCTGCCTGGGCCCTCGCTGCTTCTGTCTGGAACTTCTCCTC
154CCAGTCCACGAGAGATAGCTTGAATCTTGTCCTGAAGACAGGGCTACAATGTTGTTTCGT
155TTTTACATCTTTCCCTGAATATTCTTTCCTGAATGTATGGCTTCTTTGTCTCTGTGTCTT
156GTCACCTTATGTTGTAT
157>F2YP0BU02J14RD length=322 xy=4007_3079 region=2 run=R_2009_09_24_17_10_49_
158AATTTGGAATATATACACCATGGAATACTACACAGCCATAAAGAAATGAGATCATGACAT
159TTGTAGCAATGTGGATGTAACTAGAGTCCATTATCCTAAGCAAACTAACACTGGAACAGA
160ATCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGAAAATCAATTCCTCCTT
161TCTATTTGTGGGCCAAATGATTTCATTTAAGTCACTTAATTCTGACACTCAGTTTCCTGT
162AAACTGTAAACTCTAAAATGCAGATTACAATACTCATCTTGTCTACCCAGGTTATTGTGA
163AAATCAATGAATTAATATACGT
164>F2YP0BU02GCKL1 length=376 xy=2486_1735 region=2 run=R_2009_09_24_17_10_49_
165GTTTAAGTTCAGGTTCACATAAGAAATGGGTTTGAGTCTTCCACTGACCATATCATTAAG
166GAATGCAACAGCCATCTCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGGT
167ATTTCTTATTGTCATCTTCAATACTTAGTATCTATAAATTATAAACACTTTTGGATTTTT
168GTGGGTTTTTTCTCTCAACTGGAAAGCAAATACAAATAATAACATCTTTAAACAGAATTA
169ATCTTTAGATGTAGTAGAAGAGAATGAAACAATTGGGTTTTGGGGTTTTTTTGTTTGTTT
170GTTTGTTTGTTTTGCTTTTTGTAAACAGAGTCTTACTCTGTCGCTCAGGCTGGAGTACAG
171TGGCTTGATCTCAGCT
172>F2YP0BU02HV3CE length=220 xy=3118_3420 region=2 run=R_2009_09_24_17_10_49_
173AACCAGAATGGTGGTTCATCAGGAAATTACAACAATTAACATAAGTGCTGCAAATCGTAT
174AACTTCGTATAATGTATGCTATACGAAGTTATTACGAGACTACATATGATATTACTTAGA
175AAAGACGCTGTGGAAGTCTAACTCACATTTAAATATACTAAGATTATTTCATTCTAAAAT
176AATGAAACCATTCAGTTCTTTATCTTAGAAGGACATGATA
177>F2YP0BU02J45XB length=51 xy=4042_1197 region=2 run=R_2009_09_24_17_10_49_
178CAAGGACTAATGTCCAGAATCTACAAGGAACTCAACAATCAGCAAGAACAA
179>F2YP0BU02FXSE6 length=214 xy=2318_0144 region=2 run=R_2009_09_24_17_10_49_
180GTTTTCACATTGTTGGTGGGTCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTA
181CGAGACTGACACCTGGAGAAGTCCAGCCCTCTTGAAGGAAGGCAAACCTAAATCTTTTAA
182AATAGAAAAGCATCTTATTTTTAAAGGCTTCCAGAGACATCAAGTTCACAATTTTCCCCT
183AACTTACTGTTGGGAAACCTGTTAAAAATATACT
184>F2YP0BU02GA5V8 length=62 xy=2470_1542 region=2 run=R_2009_09_24_17_10_49_
185TCCATTTGAAGAATGATTTCCATTCGAGACCATTCGATGATTGCAGTCTGTCATTGACTA
186GG
187>F2YP0BU02HKT8Z length=297 xy=2990_2705 region=2 run=R_2009_09_24_17_10_49_
188TTTACTAATATTATCTCATTTAATACTCTCAACAAGCACACAATGTACGTATTTATTCTT
189TCATTTAATAAGTATTTATGAAATGCCCACTACTATTCACCCATGATATTCGTAATAACT
190TCGTATAGCATACATTATACGAAGTTATACGATTTTTCAAAAACAAAAGTCACATTTAGC
191AAAATATTCAGTACTGGTGATCTGGGTAAAGGGTACACGGGAATTCTTTGCACTATTCTT
192GCAATATTTCTGTAAGTTTGAAATTCATTCAGAATAAAAGAAAAAGATACTAGTGTT
193>F2YP0BU02G42KJ length=363 xy=2811_0177 region=2 run=R_2009_09_24_17_10_49_
194GTTTCCTTCTCCACACCAGCCCCTCTACACATCACAGGTGACTCTAAGCGTAATAACTTC
195GTATAGCATACATTATACGAAGTTATACGAGTCAAGAATGACTGTCAGCTTTGCATCTGG
196AGGAGCTGAGGGGATGATGGTGTCCTTGGCCGAGATGGCACAGCTTGGGGAGGGAACTTG
197TTTGAGGAAGAAAATCAAGAATTCTATTTCGGACAGGCTAAATTTGAGCTTCCTCCTGTA
198CATCCATGTGGGGATAATGAGTAGGCAGTTGGGTATGGGTGGCGGGGGGCGGGGGACGGG
199GAGTGAAGGGTTCGATTTGGAATTATGTGGCAATTAAAACCTCAAAGCTGGCTAAGATCA
200CCT
201>F2YP0BU02HD86B length=333 xy=2915_2657 region=2 run=R_2009_09_24_17_10_49_
202TTTTTTTGTACTTTCAGTAGAGACGGGGTTTCACCATGTTAGCCAGGATGGTCTCGATCT
203CCTGACCTCGTGATTCACCTGTCTTGGCCTTCCAAAGTGCTGGGATTACAGGCATGAGCC
204GCTGCACCCTGCTGAGATTTTTATTTTTAAGAAATTATTTAAATGTTATGGTTGTGAATT
205GAGTTATCCCATCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGGCTAAGA
206ACTGTATTTGGGAGACTAGTGTTTATATTTGTAGGTAAGGAGGCACACTGGCTTTTGGAG
207TTGTGAGTTGTTGTGCTGATTCTTTCTCACGTG
208>F2YP0BU02F3YKL length=277 xy=2388_1331 region=2 run=R_2009_09_24_17_10_49_
209TTGGGCACTTGTCTCTTAGACACTTTCAAGTTACCTACTGGACAGGAGAGACCTCTTCTC
210TATAAAGTATCACACTTGGAGGCTTTTCAGGCACAGGACCATAGATTGTAATATTTTCCA
211TAGCAGTTGCCCAATTTTATCTGCGTAATAACTTCGTATAGCATACATTATACGAAGTTA
212TACGACCTCACATAGTGCAGTTTGGGTTGAGCGGAGGTGGCCAGTAATGGGGGCCCCTGG
213GACTCCTGGGACCTCTGTCTTCTTCTCCCTGGAAGAG
214>F2YP0BU02HLAR5 length=447 xy=2995_3651 region=2 run=R_2009_09_24_17_10_49_
215TTTTTTGGTATTTTTAGTAGAGACGGGGTTTCACGGTGTTAGCCAAAATGGTCTCGATCT
216CCTGAGCTCATGATCCGCCCGCCCCAGCCTCCCAAAGTTCTGGGATTACAGGCGTGAGCC
217TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGCCCCCTACTGGTCTGTGG
218TTGTTTTTCTGTTGGCTGCAGCAGGCTGGCTGTGGTTTTTCNCTTGCCATGACAACTTCT
219AATTGCCATGTACAGTATGTTCAAAGTCAGGTAACTCCTTATTGTAAGCAAACTATGTAA
220CTGCCCAGAGCAGCACATATAAACCAGCCTAATGTGAAAAAAGAAGAAATAGGCCGGGCG
221CAGTAGTTCATGCCTGTAATCCCAGCACTTTGGGAGGCCGAGGCAGGCGGATCACGAAGC
222CAGGAAATCGAGACCATCCTGGCTAAC
223>F2YP0BU02GGSTZ length=300 xy=2534_2405 region=2 run=R_2009_09_24_17_10_49_
224TGGATGGACTCATCATCGAATGGATTCGAATGGAATCATCGAATAAATTGATTGAAATCA
225TCATCGAATGGAATCGATCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGC
226GAATGCAATCATCATCGTATAGAATCGAATGGAATCATCGAATGGACTCGAATGGATTAA
227TCATTGAACGGAATCAAATGGAATCATCATCTAATGGAAACGAATGGAATCATCATCGAA
228TGGAAATGAAAAGAGTCATCATCTAATGGAATTGCATGGAATCATCATATAATGGAATCG
229>F2YP0BU02JARMH length=257 xy=3696_0199 region=2 run=R_2009_09_24_17_10_49_
230TTACATTTTGCTCTCGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGATTCT
231GGGATTATAGGCCTGAGCCACTCAGTCTGGCCAATAATAACAAATTTAATTATTTTAAAA
232GTATTACTGTATTTCAGTCTTCTTTCAGCCTACAATATGGTATTAAATGCCTTACATGGA
233GACATATAAAGGATTTTACCATAATAACCTTTAAAACAAAAGTGATTTCCTAGAATTATA
234GGACAGAAAAAGAATGT
235>F2YP0BU02F6FA3 length=174 xy=2416_1645 region=2 run=R_2009_09_24_17_10_49_
236TGTTTCTTTAATTCTTTGAAGGTCGTATAACTTCGTATAATGTATGCTATACGAAGTTAT
237TACGCTTCCACCAGTGTGCATGCTCAGATTTGAAGTGAGTGTACACTGTGCCCAGAGGCT
238GTCTATGATGCCCCAGTTGGTCTTTGCATTTACTCCAGGCACGCCTTGCACACC
239>F2YP0BU02IE523 length=281 xy=3336_0509 region=2 run=R_2009_09_24_17_10_49_
240TTCTTTCTTTCTTTCTTTGTAGAGATGAGGTCTCACTATGTTGCTCAGGCTGGTTTCAAA
241CTCCTGTCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGAAAATCATTCTA
242CAGCACAGGTCCTCCCAGGTCCATGACTTACTGAGTAGATAAATGTAGCCAATACATGAG
243AAATCAAGTTAAAACCTGTCCCTGCTGAGCCAGCAGTATCTATAGCTGGGGTACTACATA
244AGTGGATTCTGGGGAGCTTATTTAGAAAAAGACCCATGGCT
245>F2YP0BU02HZ814 length=271 xy=3166_0842 region=2 run=R_2009_09_24_17_10_49_
246TTTATAATAAAATGCAATTCCTTAAAATAATTCAATCGTATAACTTCGTATAATGTATGC
247TATACGAAGTTATTACGTGACAAATCACCAGTCGAGAACTGAGCACCTTGAAATTGTGAC
248CAAATGGAATACAAAAGGTTTTTATGGACGGCTCAAAGGTTTTCATGGTTATGCAAACCA
249CTGAAAATTAGCTAGTTCAAATATATTTGATGGTACAGAAAAATATTCCCTTCACCTAGC
250AAAATGAATATAACAAAATATGGCAATCTGG
251>F2YP0BU02F8YG5 length=285 xy=2445_1015 region=2 run=R_2009_09_24_17_10_49_
252TTGCATTACCCAGAATTGGCCACCAGGGTAGGCTAGAGTTCGTATAACTTCGTATAATGT
253ATGCTATACGAAGTTATTACGCTCTTTGTTGATCCTAAAAGAAAATGGCAAGAATTTAAA
254GTGGTTTTGGATTGACAGTACCACCAAGAACCCAGCAGAAGCAATGCAGATCCTTTCTGG
255ATGAACTCATCTTTAATCTAGGCCTCGGGGAATTTCCACAGATACAGTTCCAAGAAAATA
256AATTGTGGTCAAAAATTCCAAACAAATAAGGAACGAGGCACCAAG
257>F2YP0BU02GJK8J length=290 xy=2566_1457 region=2 run=R_2009_09_24_17_10_49_
258TTTTTTCTTCTTAATAACTGAAGAGAATAACATTTATCAAACAAACGATCGAACTCTTTC
259TGAGACATAGTTTCATGTGCCTCTTTGGAGTTGATTTCCCCTCCGTAATAACTTCGTATA
260GCATACATTATACGAAGTTATACGAGTGGCCATCAGGACATTTATTAGCTGTTAATCTAA
261CCACTACCAAATGCATTAACACATTTTTTTTGACAACTTTTTCTCTTTTATTTGGCTGTT
262GCTTAGTTCAGTTTTGCTTGGAGAAGTTGTGGCAATCCTGAATTCAGTTT
263>F2YP0BU02IFF38 length=137 xy=3339_1222 region=2 run=R_2009_09_24_17_10_49_
264TTGAGAATCAAATTTCACCATTAGTTTCTGAGGGAATCGTATAACTTCGTATAATGTATG
265CTATACGAAGTTATTACGGTCAAAATAAAAAGAAAATATAGGAAGAACAGGTAAAGAATG
266GTGAAAAATATCATTGT
267>F2YP0BU02JGYZX length=265 xy=3766_2971 region=2 run=R_2009_09_24_17_10_49_
268ATTTGAGTCCATTTGATGATTGTTCCATTCGATTCTATTCGGTGATTCCATTCGATTCCA
269TTTGATAATGATTCCAATCGAGACCATTCGATGATTCCATTCAATTCCATTCAATAATGA
270TCCCTTTCGTAGTCCATTCAATGATTCCTTTCCAGTCCATTCGATGATTCCATCTGATTC
271CATTCAATGAATCCCATTCGATTCGTAATAACTTCGTATAGCATACATTATACGAAGTTA
272TACGACATTCGATTCCATTTGTATG
273>F2YP0BU02JT6YF length=104 xy=3917_1317 region=2 run=R_2009_09_24_17_10_49_
274TTCCTAGGGTCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGGACCTGCTC
275AATTTAGATTCCACTTCCAGGAGTATGAGGATCTTCTCCTGGGA
276>F2YP0BU02FL7V0 length=282 xy=2186_0990 region=2 run=R_2009_09_24_17_10_49_
277TTCCCCAAACAGACCCTAGAATAGTCTTCCTTGGAAATTCCATGAGCAAATAGCGTAATA
278ACTTCGTATAGCATACATTATACGAAGTTATACGAGTCTGTTTTAGATAAATGATGTTCA
279GTGGACCTTTCTGTGATGGTGGAAATATTCTATATTTGTGCCATTCAATACAGTAGCCAC
280TAGACTATTGGTCTATTTGCACTTGAAATGTGGCTAATGAGACTCACAAATACAATTTTA
281AATTAATTTAATTTAACTTTAAATAACAACACGTATTTTATT
282>F2YP0BU02JF57F length=249 xy=3757_2521 region=2 run=R_2009_09_24_17_10_49_
283CTATCTACAAGTGAATCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGTAA
284CTTAAGAAAACACTCCACCATTAGACAAACAAAGGCACCAGAATGCAATGAACTATAATA
285CTTTACCCATTAGGTGAGTAAGAGCCAGTAAATCAAAGGGCTTTTAAAAACACAATTCCT
286CAGCTAACACCATGAAGCAAAATTAACCATATTAGTTCTCTTCAATTTTACACTTTTGGG
287GTTAGGTAC
288>F2YP0BU02IADK7 length=500 xy=3281_2233 region=2 run=R_2009_09_24_17_10_49_
289TTTTTTTGAGATGGAGTCTCACTCCGTAGCCCAAGCTGGAGCGCAGTGGCATGATCTTGG
290CTCACTGCAACTTTGCCTCTTGGGCTCAAGTGATTCTCCTGCCTCAGCATCCCAAGTAGC
291TGGGACTACAGGAATGCACCACCACACCCAGTTAATTTTTTTGTATTTTTACTAGAGACG
292GGGTTCCACCATGTTGCCCTGGGTGGTCTTGAACTCTTGAGCTCAGACGATCCACCTGCC
293TTGGCCTCCTAAAATGCTGGGATTACAGGCATGAGCCACCATGCCCAGCCATTAAGTGGT
294ATTTCTACGTTTGCATGGCATGTGACTAAATTGATCAATATTCAATATCATGAAGGTGTG
295TGTTTGCATAATGTTGACCGGATCTAATAGGCAAACAAAGGGATATGTGAACAGAGTTCA
296AATGTATTTTAAAGATATTACCGTAATAACTTCGTATAGCATACATTATACGAAGTTATA
297CGAGCCACATTATTATTCTA
298>F2YP0BU02H62VV length=305 xy=3243_4041 region=2 run=R_2009_09_24_17_10_49_
299CTTAGATCACAACACCTAAGTCCTTTTGAATAACTGGAAGCCTTCGCAAGAAGGACAGGT
300ACAAAGAAGCTCAGACTGTAAGAACTACAGTAAATACCGAACTCTTCAAATCCCAGGAAC
301AGATAAACATCCACAAGCATCAAGACCATCTAGGAAAACATGACCTCATTAAATGAACTA
302AATATGGCACCAGGGACCAAACCTGGAGAAACAGAGATATGTGACCTTTCAGACCGTAAT
303AACTTCGTATAGCATACATTATACGAAGTTATACGAGAACATCATGGGTCTTCTAAGTAT
304GTCAC
305>F2YP0BU02GQK0T length=370 xy=2646_0091 region=2 run=R_2009_09_24_17_10_49_
306AGTGTTCTCCTTCATGAATGAATGGTTCCATCTATGTCTGCTCTATCTCAGTCGCCAGAA
307TAATGAATCAAAGAATAATTAAGCCTATTAATAAAATGGTCAATTTATTTTAATTTATTG
308GCGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGAGGCACAGAAAGACAAAT
309ATTGCATGTTCTGACTCTTGTGTAGGAACTAAAAGGTTGAATTCATTGAGATAGAGTAGA
310ATGATAGATACCAGAGGCTGGGAAAGGTATGTGGGTGGGCAAAATGAAGAGAGGTAGGTT
311AATAGGCACAAACAGGAAGTTATTTGGAAGGAGCAAGTTCTAATGGTTGATAGCAGAGTG
312GGTGATTAAG
313>F2YP0BU02JPJK8 length=198 xy=3864_1498 region=2 run=R_2009_09_24_17_10_49_
314CACAGTACCATGTCACACTGGCATTGCCTGAATCATTGCCTGAATTCAGCATAGCCTCTG
315CGCACCAGGTACTGTTCCAGGTGTCAGGGATATTGTGGTGAACAGGACAGACAAGGTCCA
316GGCCTCGTGGGGTTACGATTCTGGTGGGAGCGTATAACTTCGTATAGCATACATTATACG
317TAAGTTATACGATCTTTA
318>F2YP0BU02JYTJJ length=335 xy=3970_0125 region=2 run=R_2009_09_24_17_10_49_
319GTTTATCTTTCTTCTCATTCCATTTAAGGTCAATCTTTCCTCTAGTGCTCTTCATCCTAT
320CCCCACTTCCCTTCTTATCTAAACTCTTGTCTAGGAAATCTCATTAGCTCCTTTGGCTTT
321AACTACTAACTGATTACCTTCAGCTCAGTACTCCTGAGGAATATATCCCCACTCGTATAA
322CTTCGTATAATGTATGCTATACGAAGTTATTACGTAAAACAGCTAGGTGTTTCTGCTAAG
323AAACACTGCGTGGTAACGTTTCCCGGATAGCCCCAAAATGATCTCTATCTTCTGGTGTTT
324ACACCATGTGTAGTCCCTTCTCACAATATACATAC
325>F2YP0BU02GWFAR length=384 xy=2712_2273 region=2 run=R_2009_09_24_17_10_49_
326TTCTAAGATAGAAGTTTAGATAATTAATTTTGTAACTTTATTCTTTTAAATACATGCACT
327AAATGTTACAAATTTCCCTCTACACACTGCTTTTGCTGCAGACTACAAATTTTAATTAAT
328ATATTTTTATTTTATTGATTATTATTATTATTTAACGACAGGGTCTTGCTCTGTCACCAG
329GCTGGAAGGCAAGTAATACAATCATAGCTCGTATAACTTCGTATAATGTATGCTATACGA
330AGTTATTACGAATCCTTTGGGTATGTACCCGTGATGGGATGGCTGGAACAAATGGTTATT
331TCTAGTTCTAGACCCTTGAGGAATCGCCACACTGACTTCCACAATGGTTGAACTAGTTTA
332CAGTCCCACCAACAGTGGAAAAGT
333>F2YP0BU02JXVRY length=55 xy=3959_1420 region=2 run=R_2009_09_24_17_10_49_
334TTACCCTTCTGTATAATGGAGATGGCTTATTTTCTCAAACCTCATGAACTACCCC
335>F2YP0BU02JWAD0 length=227 xy=3941_0774 region=2 run=R_2009_09_24_17_10_49_
336TTTTTTTTTTAACCAAAGGACTAAAGTCATAGGAAGAAAAGCATACACTGGTTTTCTGGA
337CATTCCCCTGGGATTATACACACACACCATGCAACAATCACAGGCACCAGCTCCCAGCAG
338GCACATTCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGTGCAGCCCAGCC
339AGGGGCGGAGGAAGGCAGGAGTGGGGTCTGCAGCTGTCACCCGGAGC
340>F2YP0BU02GX9F0 length=48 xy=2733_1982 region=2 run=R_2009_09_24_17_10_49_
341AGTTCCGTGAGGACAGGACTATACAGTCAGCCCTCAGTATCCATGGGG
342>F2YP0BU02GRICP length=451 xy=2656_2327 region=2 run=R_2009_09_24_17_10_49_
343TTTTTTTTTTTTTTTGGTAGAGACAGGGTTTTGCTGTGTTGCCCAGGCTGGTCTCAAACT
344CCTAAACTTAAGTGATCCGCCCACCTCAGCCTCCCAAAGTGCTGGGATTATAGGTGAGAG
345CCACTGCGCCCAGCTCACGATTGTTAAATCTAAGGGCTCTGAAAATAGCAAGTTTTTGTA
346TAATTGTTTCAATGGCAAGACCTGGCCTGGACTGATGTGAAGCCGCTGGTTGTTGTTATT
347CCATCACTTCAGCTGCAGAAATACTGTGTTTATTGTGGGGGCTGCCCAGACCTGTGGGTG
348GCACTAGATAATCGACAGGAGCTCCCCTTGTAGCGTAATAACTTCGTATAGCATACATTA
349TACGAAGTTATACGATATGTGTACCTACTATTTTGGGACACAAGGGTATTAAAAACCATG
350TACTCAAGGGCTGATATTTAATAAAATTAAT
351>F2YP0BU02GIUVR length=132 xy=2558_0069 region=2 run=R_2009_09_24_17_10_49_
352ATTAGGCTGATACTACCTGAATCCAGCTTAAGACATAAAGTCATTATGTCGTAATAACTT
353CGTATAGCATACATTATACGAAGTTATACGATTGAAGGTCACCAAACCAAATCATAACAA
354TCTTCCTCAAAT
355>F2YP0BU02FJD9A length=189 xy=2154_0348 region=2 run=R_2009_09_24_17_10_49_
356AAAAGAACATGAGTTTCCAGAGCCTGGTGGCCTGGGTTAGAATCCTAGCTCTGCAACTCA
357TGGCTGTGTACTATTTGGCCAAGTAACTTAACCTTTCTGTGCTTTAGTTTCCTCATCTCT
358AAAATATGTATCTTTTTNTTTTCCCTTTCGAGACAAGAGTCTCACTGTGTCACCTCGTAT
359AACTTACGT
360>F2YP0BU02IIGW9 length=372 xy=3373_2971 region=2 run=R_2009_09_24_17_10_49_
361TTTTGTTATATTCAGGCCCGCAATGTATTGGATCGTATAACTTCGTATAATGTATGCTAT
362ACGAAGTTATTACGTTTAATTCGATGTTGTCCATGAGTTTTGTTTTTCTATTTAGTTGCT
363ATGTTTGTTTTAATTGTAAGGCAAGATTAAAATATTACACTGTCACCGTTACTACCATCC
364TCCCCAAATCCCCTCGTATTAGCTACCTAGGCTTGCTGGGTAACAAATTGTCACAAATTT
365ATTAGCAAAAGAACACACACTTGCTATATCACTGCTCTGTAAGTCAGAAGGCCAGGTGGG
366GCTCGACTGGGTTCTGCACTTAAGGTCTCACAAGATTGAAATCAAGACATCAGCTGAGCT
367GGGCTCTTATCT
368>F2YP0BU02JF0IJ length=54 xy=3755_3337 region=2 run=R_2009_09_24_17_10_49_
369AATAATAATATCATGTCCACAGTGGAGGTCTACAGGAACAAAGGAAAGAATAAA
370>F2YP0BU02HU4M2 length=275 xy=3107_3500 region=2 run=R_2009_09_24_17_10_49_
371TGCCTGTAAATAGGAATAATTCTAATAGTAACTCTCGTATAACTTCGTATAATGTATGCT
372ATACGAAGTTATTACGAGCACATAAAGATGAGGATTTAATTTTAGTATTAATGATCTCAA
373AGCTGGTTAATGTCTGACAATGAGCAGATACATGATGCAGGTATACTTCATGAATTTGTC
374TCATTTCTTGTTAGAAGCTGCTAGACTCAGTGAGCTTTAATTTGCTGAGACTGACAAAAT
375AGCAGATTTTCACTGAACCTGACTAGCTGGTTTTC
376>F2YP0BU02H8Z84 length=68 xy=3265_3830 region=2 run=R_2009_09_24_17_10_49_
377TTATTTGTTGCATTTATATGTGGGTAGATCAATAACTTAATTTCTATAGAACAATATTCT
378TTTGTTTG
379>F2YP0BU02F2LFK length=373 xy=2372_3182 region=2 run=R_2009_09_24_17_10_49_
380TTTCCTTTTCACCATAGGCCTGAAGCGATCCAAATGTCCACATCCAGATACTACAAAAGA
381GTGTTTCAAACCTGCTCTATGAAAGGGAATGTTCAACTCTGTGACTTGAATGCAAACATC
382ACAAAGAAGTTTCTGAGAATGCTGCTGTCTGCTTTTTGTATGTAATCCCGTTTCCAACGA
383AATCCTCCCAGCTAGCCAAAATATCCACTTGCAGATTCCGCAAAAAAGAGTGTTTCAAAA
384CTGCTCCTTCAAAACGATGGTTTAGTTCTGTTAGTTGAGTACATACATCTCGTATAACTT
385CGTATAATGTATGCTATACGAAGTTATTACGTATCCACTTGCAGATTCCACGAAAACAGT
386GTTTCAAAAACTG
387>F2YP0BU02HCBFV length=56 xy=2893_2393 region=2 run=R_2009_09_24_17_10_49_
388TTTATGAAACAAAGGAACTTGTCATAGTCTATTAAAGCAATCTCCTAACCCCACTG
389>F2YP0BU02GR0SM length=100 xy=2662_1652 region=2 run=R_2009_09_24_17_10_49_
390TGTTTCTCCATCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGTCCAGCAA
391GGTATTTCGATAGGAACTGTGATAATACCAGCCCTCATAG
392>F2YP0BU02GN26J length=416 xy=2617_2441 region=2 run=R_2009_09_24_17_10_49_
393GGTTTATATGTACCATGTTTTATTTATCCCATCCGCTGTTCATGGGCACATAGGTTGATT
394GATTCCATGTCTTTGCTATTTTGAATAGCACTGCAGTGAACATATGGGTGCATGTGTCTT
395TTGGATAAACGAATTATTTTCTTTGGGTATATATCCAGAAGTGGGATTCCTGGTTTAAAA
396TGGTAATTCCATTTTTAAGTTCTTTGAGAAATCTCCAGACTCGTAATAACTTCGTATAGC
397ATACATTATACGAAGTTATACGATTATCTGTATTACAGGGAATAATGTGATATTGGAGTT
398ACTATGTCCATTATGTTTTAAAGCTTTTTCTCAGTTTTAGTACTTTAAGATGACATAAGT
399TGTGTCATCCTTGAATGTGTTGGCTATTGCATGAAAAGACCCTATATTTACTTTTG
400>F2YP0BU02HGJBL length=377 xy=2941_2623 region=2 run=R_2009_09_24_17_10_49_
401TTACAGGCATGAGCCACCGCACCCAGCCTCTATTTCCTTTTAAAATTGAATGCCTTTAAC
402AGCACCCAAGTCACCTCTTGAATGTTGTATTGCTTAGAAATTTCATCCGCCAGATACCCT
403AAATCATCTCTCTGAAGTTCAAATTTCCACAAACCTCCAGGGCAGGGGCAACATGCCACC
404AATCTTTTGCTAAAACAAGTTATAGCAAACAACTTCCTCCGTAATAACTTCGTATAGCAT
405ACATTATACGAAGTTATACGATGATAATGGTAGTTGATAATGGCAGTTCATGGGTGAAGT
406TGCTCAGGAAGAATGAATATACTGTGAGACAAAATGACCACTACTGTTTGAGAGCTACGT
407TGAAGAAGGGGAGCCTG
408>F2YP0BU02HEDVO length=61 xy=2917_0562 region=2 run=R_2009_09_24_17_10_49_
409TAAGCCACTCACACTCCTCCAAAGGCAGTCAGAGCTCCTTCAGCTTGCCCACCTACTCTC
410T
411>F2YP0BU02II7P9 length=196 xy=3382_0847 region=2 run=R_2009_09_24_17_10_49_
412ACAGTGAGACTCTGTCTCAAAGAAAGAGAAGAGGCCTGGTGCAGAGGCTCACGCCTGTAA
413GCACTTTGGGCGGCCGAGGTAGGCGGACCACTTGAGGTCAGGAGTTCTAGACCAGCCTGG
414GCAACATGGCAAGATCCCATCTCTAATAAAATCGTATAACTTCGTATAATGTATGCTATA
415CGAAGTTATTACGTAA
416>F2YP0BU02IDY8I length=200 xy=3322_2320 region=2 run=R_2009_09_24_17_10_49_
417TTTAAAATGTCTATTAGCAGTGATGTTTGAACTAGTCTTTTGAGAAGTGTGAAGAGAACA
418GGAAAAGTCTGTCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGTATACAC
419ATTTCGGGGCTGAGAGGCTAAAATGAGAATGGCGCAGCGGACGGGGAAGGCTTCTCTGCA
420CACAGCTGCTGGGATCTGAG
421>F2YP0BU02GLX2B length=189 xy=2593_0801 region=2 run=R_2009_09_24_17_10_49_
422AGTAATAAATAAAATCAAGGCTGGGGAATTACTACCAAGCTAAGCTCTGAAATCCAAAGC
423AAGAATTTAATATTTCCATTTTTCTGGCCGTAATAACTTCGTATAGCATACATTATACGA
424AGTTATACGATATGCCGATATTGTTAGTTTTAAGACATCAGTAGACTGGTTTTTTTGCCA
425CCAGCTTCT
426>F2YP0BU02JDE7P length=88 xy=3726_1203 region=2 run=R_2009_09_24_17_10_49_
427GAATGGAATCATCCGTAATTGAATGGAAAGGAATGGAATGGAATGGAATGGAATGGAATG
428GAATGGAATGGAATGGAATGGAATGCGT
429>F2YP0BU02IZKK3 length=117 xy=3568_2149 region=2 run=R_2009_09_24_17_10_49_
430TTTGTAGGATTTTAAGAATCAACAAAATTTTCTTTAAAATAAATCATTGTGTCCCTGTGT
431GTTGAAGTATGGCTTTGGTCAGTCTGTATTTATGTTTTCTTCGAATTCTTCTTAGAA
432>F2YP0BU02IVEHV length=49 xy=3521_0145 region=2 run=R_2009_09_24_17_10_49_
433CGTTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCTATTCGGTT
434>F2YP0BU02GJJC7 length=469 xy=2565_3129 region=2 run=R_2009_09_24_17_10_49_
435TTTTTCTAAAAGACATCTGAATAAGGAGTTCGTAATAACTTCGTATAGCATACATTATAC
436GAAGTTATACGATATTGTCTCTTTAAAAGCTTTAGTTCCTTTTTAAAAATCACACTTGGG
437TCATTATCAATGCTTTTTGCAAGCATCAGCTCTTTCTGGGTTTTAATTTGATGTAATTCA
438TTAGTGTTTCTGACACACCTTACAGGTTTGCACCACTCTCTGAAACTGCCCTTGATTGAG
439TAACCTCCTTGTTCACTTTTCTGACTTATTCTTCTAAAACCTGAGCTCTCCAGTGATTTT
440GGGAGATTTTACCCCTCATTGGTGACTTGAAGTTTCTTCTTCTTATCTTCTTTGCTAGAA
441TAACTTCTTGTTAAACAATCAGAACTCATTGTGTTTCCTCTCTTCTTCCTGAATCCTATT
442GGCTTTTATACATTTTAGGAGCAGAATTGAACTAAAGAATAAAACATGT
443>F2YP0BU02HLBKR length=61 xy=2996_0585 region=2 run=R_2009_09_24_17_10_49_
444CAATGGATTCAACTCGATTGCAATGGAATGGAATAGAATGGAATGGAATGGAATGGAATG
445G
446>F2YP0BU02IFSP4 length=259 xy=3343_1178 region=2 run=R_2009_09_24_17_10_49_
447TTCTTACACCAGCCACTCACTGGCTAGGAATGATGTCAAGAGACGGTTAGCCATCTCTTG
448GAATGCTTCTCAGCAGCAGTCTTACACTTGGAAAAATAGACTCGTTCCTTTCCCCATGGG
449CAAGAATAGATAACAAAAGAAATAAGCTATCAAAACAAGGGCAAAGTTGTCGTATAACTT
450CGTATAATGTATGCTATACGAAGTTATTACGAGAAGAATGTAGCACAAATTTCTTGAGGA
451AACACAAAGAACTTCATGC
452>F2YP0BU02HV3I0 length=372 xy=3118_3658 region=2 run=R_2009_09_24_17_10_49_
453TTTGTGGAAGTGGACATTTCGCGTAATAACTTCGTATAGCATACATTATACGAAGTTATA
454CGATCATCATCAAAATGTAGAGAGAAGCACTATTAGAAACTACTTGGTGATATCTGCATT
455CAAGTCACAGAGTTGAACATTCCCTTACTTTGAGCACGTTTGAAACACTCTTTTGGAAGA
456ATCTGGAAGTGGACATTTGGAGCGCTTTGATGCCTTTGGTGAAAAGGAAACGTCTTCCAA
457TAAAAGCCAGACAGAAGCATTCTCAGAAACTTGTTCGTGATGTGTGTACTCAACTAAAAG
458AGTTGAACCTTTCTATTGATAGAGCAGTTTTGAAACACTCTTTTTGTGGATTCTGCAAGT
459GGATATTTGGAT
460>F2YP0BU02GJRKA length=308 xy=2568_1464 region=2 run=R_2009_09_24_17_10_49_
461ATTGTGGTCAGAACAATACTCAATATAATTTAAATCTTATATTATTCAAGAATTGTTTGT
462GGCCTAACGTGTGATCTGTCCTAGAGATTGTCTCATGTGCAGTTGAGAAGAATGTACATT
463CTTCAGCTGTTGGATGGAATGTTTTGTATATGTCTGTTAGGTTCATTTGATCTAGAATGT
464AGATTAACTAGGATGTTGATTTATTTCTGTCTAGATGACAGAAAATTCTGGTCGTATAAC
465TTCGTATAATGTATGCTATACGAAGTTATTACGAATGATGCGCTTCAAAGAGTTGTCTTC
466TATGCTTT
467>F2YP0BU02I60SJ length=372 xy=3653_1585 region=2 run=R_2009_09_24_17_10_49_
468TTTTGAAGGAGCAGTTTTGAAACCCTCTTTTCTGGAATCTGCAAGAGTATATTTGCCTAG
469CCTTGAGGATTTCGTTGGAAACGGGATTGTCTTCAGATAAAATCTAGACAGAAGCATTCT
470CAGAAACTTCTTTGGGATGTTTGCATTCAAGTCACAGAGCAGAACATTCCCTTTGGTAGA
471GCAGGTTTGAAACACTCTTTTTTAGTATATGGAAGTGGACATTTGGAGCGCTTTCAGGCC
472TACGTTGGAAAAGGAAACGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGAG
473ATTTCGTTGGAAGCGGGAATTCGATACAAATTGCAGACTGCAGCGTTCTGAGAAACATCT
474TTGTGATGTTTG
475>F2YP0BU02FZ6UJ length=56 xy=2345_1561 region=2 run=R_2009_09_24_17_10_49_
476TTTTGTACCTGGTGAACGATGTGACTGTCTCACAGATTTTTAAAATATGTAATGAC
477>F2YP0BU02FYXT9 length=243 xy=2331_0575 region=2 run=R_2009_09_24_17_10_49_
478AGAAGAATTTCTGAGAATGCTGCTGTCTACCTTTATTTGAATTCCCGCTTCCAACGAATC
479CTCCAAGCTATCCAAATATCCACCTGCATTTTCCACAAAAGAGTGTTTCAAAACTGCTCT
480ATCAATAGAAATGTTTCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGATG
481AAAGGGAATCTTCAACTCTATGAGTTGAAGGCAGACATCAGAAAGAAATTTCTGAGAATG
482CTG
483>F2YP0BU02GP5KL length=263 xy=2641_0547 region=2 run=R_2009_09_24_17_10_49_
484AACCAGAATGGATTGGAATATAATGGAGTGTAAGGGAATTGAATAGAATCAATCTGAATG
485TAATGAAAGGGAATGGAACTGAAGGGAATGGAATGGAATGGAATGGAATGGAATGCAATG
486GAATGGAATCAACCCGAGTGCAATCGAATGGAATACGGAATGGAAATGGTCGTAGTAACT
487TCGTATAATGTATGCTATACGAAGTTATTACGAATGGAGTCATCCGGAATGGAACAGAAA
488GGAATGGAATGGAATGAACTGAN
489>F2YP0BU02JGZBK length=296 xy=3766_3390 region=2 run=R_2009_09_24_17_10_49_
490TTTTGATGCCTCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGAGATCATG
491GATATTCTGGAAATAAAGGCTTTCGAGTAGTATCTTGCATTTTTCTCAACAGATTTCAAG
492TGTTGAACCGTTATAGAGGAACAACGCAAAGGACTAAAATAGTCAAGTAAAGTTGTATGG
493ATGAGAAGAAATGCAACGAAGGGAGTTCATCAAAATGTAGTCTTCTAACCCACATTGGTT
494TGCTAGATAGCATTTAAATTTGAGAGCTTGACTTTGAGGTTGAATATTTAATTTCG
495>F2YP0BU02H0L6E length=52 xy=3170_1460 region=2 run=R_2009_09_24_17_10_49_
496ACATCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGTGGAGAA
497>F2YP0BU02HOYJH length=292 xy=3037_2379 region=2 run=R_2009_09_24_17_10_49_
498TTACTTAACCTCTCTAGGCCAAACTTTCCTCATCTTTAAAGTGGGGTTAATAAAACTCCG
499CTTCTTATTATGAGGTCTAGATGAGAGAATGTTTGTGAAGTGCTTAACATGGTATGTGGA
500AAGACAGTATTCATTATTCATTAAATCATGACCTATTAGATAAAATAGTTTTTTAGAGGG
501GTTATGTGTGCTATGATTGTGGGAGTTTGGTGGAAGGGATTAACGTAATAACTTCGTATA
502GCATACATTATACGGAAGTTTATACGATGCAATTCAAGTGGAAGCTGTCTTC
503>F2YP0BU02GSQKZ length=282 xy=2670_2305 region=2 run=R_2009_09_24_17_10_49_
504AGATGGCCTTACAAGTATTGCTTTCTGCATTTTATTGAAGAGGAAATGAGACTCAAGGTA
505AATGACTGATTCAATGCCGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGAC
506TTGAATTCCTGAGCTCAGTCCTCCACACTGCAAGTATTACAGGTGTGACCCACTCTGCAG
507CCAGTTTAGGTACTCTATCCTATTTTACAGTTGAAGAAACCGACACCTAGAGGGAAGGTA
508ATTTGCCCAGGTCACATGGCTAGTAATTGATGGGACTGGCAT
509>F2YP0BU02HNS0A length=234 xy=3024_1800 region=2 run=R_2009_09_24_17_10_49_
510AGTAGATAGGCAAGTTCTCTAGGAAATATTACTCATACAGCCTAAGAATGTTAATTTGGC
511TCTCCCTCACTGGCAAGGTAACAAGTCCGTAATAACTTCGCATAGCATACATTATACGAA
512GTTATACGAGAAATGTATTACATAGCCAAATACAGTATGTATAAAATATATATTGCAATA
513TTTCATACTTGTTAGTGAAAATATTTTTACAACGTAGTGCCTCCCAAGTGCAGG
514>F2YP0BU02G28U1 length=206 xy=2790_1035 region=2 run=R_2009_09_24_17_10_49_
515TAATATCTTATGAGTCAAGGACAAACCAAAGAGAAGCCAACAGCATTTTGAACTTCGTAT
516AACTTCGTATAATGTATGCTATACGAAGTTATTACGCTGGGCAACCACTAATCTGTTCTA
517CATCTCTATAGTTATGATATTTTATAAATGCTATATAAATGGAATCATGCAGCATGTATC
518CTTCCGACGATGACTTTTTAATCTCA
519>F2YP0BU02HU8CF length=278 xy=3109_0109 region=2 run=R_2009_09_24_17_10_49_
520ATGGAATGGAGTGGAATGGAATGGAATGGAATGGAACAACCCGAATGAAATGGAATGTAA
521TGGAGAGTAAGGGAGTTGAAAGAATCAATCCGAATGGAATGGAATGGAATGGAATGGAAT
522GGAACGGAATGGAATGGAATGGAATGGAATGGAATGGAATGCAATGGAATGGAATCAACC
523CGAGTACAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATCGTATAAACT
524TCGTATAAATGTATGCTATACGAAGTTATTACGAATGG
525>F2YP0BU02G140S length=444 xy=2777_2650 region=2 run=R_2009_09_24_17_10_49_
526TTTTACACCAGTCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGCCAAAAG
527CAATATCCAGTACATCATATGTCGCACATAAGTGTCATTTGCTGTTACTGTTTTTATTAT
528TATTATTAAAGATAAGGAGACTAGATAGGCTTTGAAAAATATATGATGAATTTGTTTTCA
529GTCACTTTGAGTGCTAAATAGAAATTCACTTCCTGAGTTTCTAATGATCGCCATTCTAAC
530TTGTGTGAGGTGGTATCTCATTGTGGTTTTGATTTGCATTTCTCTGATGGCCAGTGATGC
531TGAGCATTTTTTATGTGTCTTTTGGCTGCATAAATGTCTTCTTTTGAGAAGTGTCTGCTC
532ATATCCTTTGCCCACTTTTTGATGGGGTTGTTTGTTTTTCTTGTAAATTTGTTTGAGTTC
533ATTGTAGATTCTGGATATTAGCCC
534>F2YP0BU02HZ20Y length=299 xy=3164_1216 region=2 run=R_2009_09_24_17_10_49_
535ACCAGAGGCTCAAGATACCCAAGTAAATACCCAGGATTTCCAGGGAGAAGTAAAGCAAAG
536ACCTGGCAAGTGTTATCACTGCAGCCATAGTTAATTCAAATGTTCATGGATGCAACTTCA
537ACTATAGACATTTGACCACCTGTTATCGTATAACTTCGTATAATGTATGCTATACGAAGT
538TATTACGGTAAAGCACTGAGAGAAGCGACATTGGAGGAGAGAGAAGGAAGAGAGCCAAGA
539AGGATGAAGGCCCTCTGAGGAGTGAGATGCTTGGTGCTATTGGAAGGAGGATGGAGGGC
540>F2YP0BU02J3VA9 length=291 xy=4027_2227 region=2 run=R_2009_09_24_17_10_49_
541TTTGCTTTCCATTTTTGGCTCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTAC
542GTCCACCATATTAACTGGCCTTATTAATTTCCTAGGGTTGCCATAACAAAGTACTGTGAA
543CTGGGTGGCATAAAACAGTACAAATTATTCTCATGGTTCTGGGGGCTAGAAGTCCAGAAT
544AAAGGTCTGATAGGATCATGTTCTCTGTGAAAGCAGTTAGAGGAGAATCCTTCCTTGTCT
545CTTTTGGGTTTCTTGTGATTGCCAGCGATCTTTGGTGTTCCTGGCTTGCAA
546>F2YP0BU02FW49S length=358 xy=2310_2910 region=2 run=R_2009_09_24_17_10_49_
547TTCCATTCAAGTCCATTCGCTTCCATTCCATTCCATTCCTTTCCATTCCGTGCCATTCCA
548TTCAATTCTATTCCATTCGACTCCATTCCATTCCATTGCCTTCCATCCGATTCCATTCCA
549TTCTATTCCTTTCCATTCCGTTCAATCACATCCCATTCTTTTCCATTATATTCGAGTCCA
550CTCCACTCCAGTACATTCCGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
551TTGCTTTCCCAGCCCATTGGCTTAATTCAGCCCTTAATGCTCTTCCCCTTTGGAATGCAG
552GTGGTTTAATGAGAATTTAGGTTCTCAAGTCAGATTGCCTGGGTTCACATCTAGCTTT
553>F2YP0BU02GWHIX length=297 xy=2713_1063 region=2 run=R_2009_09_24_17_10_49_
554TCTTTGGATGTTCCAGTAATGTATGTGTTCAATCCATTTGTCGGTCTTCCATAGTTCTCA
555TTTTCTCTGTAATACTTGAGTTTTGCTTTTCAGATGTTTGCTTAGATAATTTTGTATAAC
556GTAATAACTTCGTATAGCATACATTATACGAAGTTATACGACATCTTGCTTCTTAATTTA
557TTTTATTTTTAAATTTTATTTCATCTAGAGTTTACAATACACATCTTTAACTTATCACAG
558CTCTATGTAGAGTATAAAGAATGTACAGCAGGAGAAGTCAGTTTTTCTCTTCTGTCT
559>F2YP0BU02GIT1L length=445 xy=2557_3079 region=2 run=R_2009_09_24_17_10_49_
560TTTTTTGTTTCCTCAGTTTTTCATTCCTCTGTTTCCCCCTTTCTACCTTCTGTGGGGTTA
561TTTGAACACATTTCTTATCGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
562GTGTTGGTATTATCTACATCTAAAAACAAAATTGGCATGGAAGTGGGAATAGAAAGAATG
563AGAAAAGAGGAGGCGAGAGGGTGGCTCAACAGTTGAGACAGGTTTTCAAGAGTAAACCTC
564AAAAGGGCTTCTGGCCAGCAGGGTCAGGAGCAAACTTTTCTATAGCCTGAGGCTTTTTAA
565AGGGCCCGGTGGGGAATTGTGCTTTGAAGCAAGATTCTATTAGGGAGGGTTTGGAGAAGT
566GCTGGCTGTTCTGTTAGGGCCATTATGCTCTGTTGAAGCTATGGGCAGGGGTGACATTCG
567GGGGTTCTGGGCCAGGGTGGCCAAA
568>F2YP0BU02IMSS7 length=364 xy=3423_0201 region=2 run=R_2009_09_24_17_10_49_
569TTTTTTTGAGACGCGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGATGTCA
570ACAAGGCGGCCCCCATAGGCTGGAGGCTATGCTCTGGAGAAGAGTGCACCTGTGAATTCT
571TGACAGAGACTGCTCAGCAGCTGCAGGATGGCTGCACCTCCCTGGTAAGGGAGGTCTATA
572TGTATCAACTGTTCTCAACCTTACAAAATATATTATTTTAACCCCAGTCTTCTAATACAG
573TTGCTTGCTGTATGTTTGGTCCTTAGCAAGACCAGCTTTCCAGAGCAGTGCCCAGGGCTG
574GCTCTAATCACATCACCTTCCTTCTTCCTATCACAATTATCCCCTCTGGATCTCATTTGT
575GGAT
576>F2YP0BU02JTR7A length=406 xy=3912_2676 region=2 run=R_2009_09_24_17_10_49_
577TTTTTTTTTTTTTTTGAGGCGGAGTTTTCGCTCTTGTTGCCCAGGTGGGAGTGCAATGGT
578GCAATCTCAGCTCGCCACAACCTCCGCCTCCCGAGTTCAAGCGATTCTCCTACCTCAGCC
579TCCCAAATAGCTGGGATTACAGACATGCACCACCATTGCCTGGCTGATTTTGTATTTTTA
580GTAGAGACGGGGTTTCTCCACGTTGGTCAGGCTGGTCTCGAACTCTCGTATAACTTCGTA
581TAATGTATTGCTATACGAAGTTATTACGCCCAAAATTTACTAAATCAGAATATACATTTT
582AACAAGATTTCCCTGAGTGATTTCTATGCACATTAAAGTTTAAGTTGGTACATTTCTTGA
583CTGGGAATATTACTATGTTACTCGATATTGTCTGGCATGCTGTTAG
584>F2YP0BU02JHSQ4 length=341 xy=3776_0574 region=2 run=R_2009_09_24_17_10_49_
585AATCACTTGAACCCGGGAGGCGGAGGTTGCAGTGAGCTAAGATCATGTCACTGCATTCCA
586GCTTGGGCAACAGAGACTCCATCTACAAAAAGTAAACTATATCCTTAGTCAAGTAATCCC
587ATCGTTAGAACTCTCTGGCCATCGTTCAGTCCGTAATAACTTCGTATAGCATACATTATA
588CGAAGTTATACGATAGCATAATTTGTGTATTTCCCTTAAAATATTAATTTTAATATCCTG
589TGCATCAGGCAGTTTCCTCAGCTCTTATTCTTTATCAGGAACCCTTCCCATGTCTTTTGG
590TTATGATGATATCATTGAATCTACTGGAGTCCAGCAGTGGC
591>F2YP0BU02GDLVC length=394 xy=2498_0870 region=2 run=R_2009_09_24_17_10_49_
592GAAGTAGCTGGGATTACAGGACATGAGCGCAACCAAGAGACATTTTTAAAGTACCAAGTT
593CCCAGGTTCCAATTCTAGACCTACTAAAAGGAAAATTATTCACTGGATGCTTTGGAGGTG
594CTAGACAGCCCTTCTAACACACACACCATGTGCTTTGCTTCCCAAGCACAATTCTCTAGC
595AATAAAAAGGGGACTGTCTAGAATACAACTTACCTGACAAATGATACTCTCTGGCTTGTT
596ACACGAACTATCCGTAATAACTTCGTATAGCATACATTATATGAAGTTATACGAGGATCA
597GCTGTTCACACCATCATGGCCAAGAAAGGCCAAAATAGCCATAGGACTTCTAGAATTTGT
598GGAAGATGTTTTCCAATGGCCACTACGGAAATTT
599>F2YP0BU02H1CSQ length=248 xy=3178_3192 region=2 run=R_2009_09_24_17_10_49_
600TTTCTTTCTAAGCTGAGAAGACCTTTATATATCATATATATAACATATAAATATATATAA
601TTTCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGGATTGACCTGCCTCAG
602CCTCTCAAAGTGTTGAGATTACAGGCCTGAGCTTCTGCTCCCAGCCCACATCCCATTCTT
603GAACATTTAGATGTTCTTCTTTTCCTCCTATAAATAACACAAGTACACAGGAATTTATAA
604TGTCCTCT
605>F2YP0BU02GGAIJ length=65 xy=2528_3241 region=2 run=R_2009_09_24_17_10_49_
606TGTGATGATTGCATTCAAGTCACAGAATTGAACATTCCCTTCTACAGAGCAGGTTTGGTA
607AACAA
608>F2YP0BU02JS9DO length=291 xy=3906_2858 region=2 run=R_2009_09_24_17_10_49_
609ACATCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGGTTCTACTCTGTGAC
610TTGAATGCAAACATCCCAAAGAAGTTTCTGAGAATGCTTCTGTCTAGATTTTCTCTGAAG
611ACAATCCCGTTTCCAACGAAATCCTCAAGGCTAGGCAAATATACTCTTGCAGATTCCAGA
612AAAAGAGTGTTTCAAAACTGCTCCTTCAAAACGGTGGTTCAATTCTCTTAGTTGAGTACA
613CACATCTCAAATTAGTTTCTGAGAATGCTTCTGCCTAGTTGTTACGGGAAG
614>F2YP0BU02GM4B1 length=165 xy=2606_2335 region=2 run=R_2009_09_24_17_10_49_
615TTTTGGAGCTCACAGAGTCCTATACTGAAAACTGAATATCCCACAATAAAACTAGAAAGA
616AGATTCCTGTTAAACTACTATGTGCGTAATAACTTCGTATAGCATACATTATACGAAGTT
617ATACGAGTTTGTGATGTGGGTATTCAGCTCATAAATTAAAACCTT
618>F2YP0BU02HGA3Q length=248 xy=2939_0164 region=2 run=R_2009_09_24_17_10_49_
619AGTTGTCTCTCTTTAAAGAGAGAGATGGCTGGTCACGGGGCTCCTGTCTGTAATCTCAGC
620GCTTCAGGAGGCTGAGCGGAAGGATCGCTTGAGATCAGGAGTTCAATACCATTCTGGGCA
621ACATAGCGAGACCCCTGACTCGACAGAAAAATACCAAACGTAATAACTTCGTATAGCATA
622CATTATACGAAGTTATACGAACTTATATGTGTTCTTTTGAGAAGTATCTGTTCATGTCCT
623TTGCTCAC
624>F2YP0BU02H0Y31 length=236 xy=3174_1839 region=2 run=R_2009_09_24_17_10_49_
625TCTGTGTCTGTTTGTTCTGTGCTGTATCCTAGAATTTAGCACAGTGCCTGGTATGTCAGA
626CATTACTAAATATAGATTGACTGAATGCAATGCCTATTAGATGAACTAGTGAATCGTNTA
627ACTTCGTATAATGTATGCTATACGAAGTTATTACGGAGGAGGTACAGCATTGACAATGTC
628TTTCTGAATTATCCTTATCTTTGGGAGGCAATCCTTATACCCTAGCTGCAGAGATA
629>F2YP0BU02IYXL2 length=83 xy=3561_1048 region=2 run=R_2009_09_24_17_10_49_
630CTTTCAACTAATGGTGCCAAGATAATTGGTAAGCTACATGTAGAATTACGAAACTGGATA
631ATCATCTCTCACCTTATACAAAA
632>F2YP0BU02HJR12 length=382 xy=2978_2360 region=2 run=R_2009_09_24_17_10_49_
633TTTACTTATAATGCCTAATACAATGTAAAGGCTGTGGAATAGTTGTAATACTATTGCATT
634TAAAATTCATTTTATTTTTAATTGTTGTAGCATTATTTTTGTTTCTGTTCTAAAATATTT
635TCAATCCACAGTTGAATACAGAACCTGCAGCTACAGAGGGCTGATTGTACATGAGAAACT
636TCAGAGGAAAATGAAGACACAGAAAGTAGTTGGTTCTAAGTGCTTACACACTAGGTTGAA
637CAAACAGTAGTCGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGATGCAATA
638TGTAAATTACATGCAAGATTTCATTCACCCTTTACCATTTTAGTTCCAGCTGGTATTTGG
639GGTTTTGGAAAAGTCCAAAACT
640>F2YP0BU02F5BIN length=392 xy=2403_3325 region=2 run=R_2009_09_24_17_10_49_
641TTTTCATGGCAGTGCAGTTAATAATCCGTAAGAACAAATATTTTGTTTAAAATTACCTTT
642TGAAATAGCAAAACCGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGATGTT
643AGGTAAGCTGGACTGAGGGACAAGGTCATGTCCTCATAGAAAAGTCACAAACCTCGCTGG
644CTAGTATCTGTGGTTCTGTAGTAGAGGCACTTCTCAGGGTGAAGAGGAGGTGGGTGTTGG
645CCTAGTCCCCAAGCCTTTTTAAATATACATATCAAATTATTAACACCAAAATGAGACATT
646GTTTTTGTTTTAGTTTTGTTTTAATTTTAGAAGTGGGATAGCGGAAAACCCAAAGTGATC
647ATCTGCTCTTAGCACAGAGCTAAGCGTCTAAG
648>F2YP0BU02I8G7G length=386 xy=3669_3978 region=2 run=R_2009_09_24_17_10_49_
649TTTTGCTTAAATACTCTTGGTAATATACTATATACATTATTAGTACACAGAGCAAAACAG
650AAACTGGGGAATCACTTGAGAAACATCATACGTAATAACTTCGTATAGCATACATTATAC
651GAAGTTATACGACGAGAACTACGTGATGCATACACAAGCTTCAATAGCCAATTCGATCAA
652GTGGAAGAAAGGGTATCAGTGATTGTAGATCAAATCAGTGAAATAAAGCGAGAAGGGAAG
653TTTAGAGAAAAAAGAGTAAAAAGAAATCAACAAAGCCTCCAAGAAATATGGGACTATGTA
654AAATGACCAAATCTACGTCTGATTGGTGTACCTGAAAGTGACAGGGAGCATGGAACCAAG
655ATGGAAAACACTCTTCAGGATATTAT
656>F2YP0BU02H927V length=466 xy=3278_1081 region=2 run=R_2009_09_24_17_10_49_
657TTTTTTCCTCTTCATTTCTTGGGGGAAGAAGGAACACAGCAAACAGTCACTATAGACAAT
658TATTTAGACATTTCTATTATTATTTAGGGAGAAATTAGGTCGTATAACTTCGTATAATGT
659ATGCTATACGAAGTTATTACGATTGATTTGAAACATTTTTTCTTTTGTAATATACCCATT
660TCATGTTACAGATCTCCCTCTGAGCACTTTTTAGATGATCTCACAAATTTGCATAAATTC
661TGTATTAATTTTTATATAGGTAACATATTTTCTAATTTTTCTTTTGATGTATTTCTTGAC
662ATATCCATGGATTATTTGAAGTATCATGTTTAACTTCTAAATATTTGGGAAATTTTTAGG
663GTATCTTTCTATTATTAATTTCTAATTTCATTCTGTTGTGGATAGACAACATATATTGTA
664TAATTTCAATCATTTTAACTTTACTGAAATTTGTTTTATTGTTACT
665>F2YP0BU02HOCK5 length=284 xy=3030_2599 region=2 run=R_2009_09_24_17_10_49_
666TTCCCATGGAGCACTGCATGGAAGCCCCAGGGGGCCGTACCCATGTCACCGGCACTCCAT
667GTGTGGGTGGAGATCTCCAACTCCAACAAAAGATAGAGCTCTCTTGGCAGGAATGACAAG
668TGACAAAGTTCTCTATCTTACCCCGTGCCTTAAAATGATCATCTGAGTGTCCCAGAGTAA
669ACAGTAGTATTTGTAAAAATAAAAATATATATTTTTCTATTGAATATGTATATATACGTA
670ATAACTTCGTATAGCATACATTATACGAAGTTATACGAATGACG
671>F2YP0BU02G2GAG length=146 xy=2781_0870 region=2 run=R_2009_09_24_17_10_49_
672CAACATGAAATCCTATTTTAAGATCCTAAACTTCAGTTTATAAACTCGTATAACTTCGTA
673TAATGTATGCTATACGAAGTTATTACGATAGGGTGATGTATATATCTATTTCTACCCTAA
674ATAAGGAAAGCTGCAACTTTTTTCTT
675>F2YP0BU02JVSW4 length=224 xy=3935_2710 region=2 run=R_2009_09_24_17_10_49_
676AGCAGGACTCAGAGTCTGGTGGAAAGATAATTTATATAATATTTATAATGTAATAATGAA
677TTAATACTACCTAAATTGAACCATACGTAATAACTTCGTATAGCATACATTATACGAAGT
678TATACGAGGCTCAGGCAGGATTATTTGAACCAGGAGATACCGGTGTCAGGAAAGCAAAAC
679CCAGCATTTTGGGAGGCTCAGGCAGGATTGTTTGAAACCAACTT
680>F2YP0BU02G47T9 length=277 xy=2812_2911 region=2 run=R_2009_09_24_17_10_49_
681AACAATGTGAATAGTTCTGAAATAATGTCGTATAACTTCGTATAATGTATGCTATACGAA
682GTTATTACGGGCTCTGTGGGAGATGCAGTGGAAGCTTCAATTAGCCAAGTGGAAGTTTCT
683ATTACAAATAAATAAGCATTTAGTTAATTTCTTAGCATAATGAATGTGGTTTTAGAGGTT
684TCAGGATATGCACTATTCAATTCTCATTAGCCTTTTTATTGTCATCTTTATTCATCAGTT
685GTGGTGCCACTTGCCATGTAATGTTTTCCTTCTATCC
686>F2YP0BU02GKDRF length=348 xy=2575_1561 region=2 run=R_2009_09_24_17_10_49_
687ATGATCACCACGAGTTACAGATTTCTTTGTTCCCTCTCCATTCCCACTGCTTCACTTGAC
688TAGCCTAATCCTTCCAAAGGAAACGTAATAACTTCGTATAGCATACATTATACGAAGTTA
689TACGATGCCTTAGTTTGATATTGTAAATATCACAATATCACAATTGTCACAACATTTACA
690ATATCAAAATAAGCCAGGAATACCAAAAATTAAACCCACATGTCAATTTGAGAAAAATTT
691ATAGGACTATGACATGCATTAATTTGTCTTCTAAAAAATCTTCCATTAAAGTGTTGTATT
692TTTTCTTTTGATTCCTTCATTACATCAGGCTCTGTCCTTGAATTCCTT
693>F2YP0BU02I6CRD length=70 xy=3645_3207 region=2 run=R_2009_09_24_17_10_49_
694ATTCTGACTATCCGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGATGGGCG
695GACTACTACT
696>F2YP0BU02G63QT length=232 xy=2834_0803 region=2 run=R_2009_09_24_17_10_49_
697ATAAACTAGTATGTTTCCGAGTCGTATAACTTCGTATAATGTATGCTATACGAAGTTATT
698ACGCTCTAGTTGTCTGCAATAAATAAATTATCTTGCTGCAAAGATGCAAAGCACATTAGA
699AATTCACCAATCATGTTCTATGGGAAAGTAATTTCAAGAGAGACAAAAAGGGAGATGGAT
700GTTAGAGAGGCAATCCAAAAATGTCTGATATACAAGACAATACACCTTCATC
701>F2YP0BU02GLOJ1 length=75 xy=2590_0767 region=2 run=R_2009_09_24_17_10_49_
702TTTCTGTAGTAACTGGAAGTGAACATTAGGACCGTAATAACTTCGTATAGCATACATTAT
703ACGAAGTTATACGAT