PageRenderTime 20ms CodeModel.GetById 11ms app.highlight 3ms RepoModel.GetById 2ms app.codeStats 0ms

/test-data/extract_genomic_dna_out5.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 258 lines | 258 code | 0 blank | 0 comment | 0 complexity | db07dc8d87c22de24b74b320d3095b2b MD5 | raw file
  1>mm9_chr10_62044837_62045189_+
  2AATTACAAGATCGACACACCAAGATAGGCAGATCCATGGTTGGTTTTACT
  3TTGTAAATCTAAAAGTATGTTGGAAAACGATGCAATGAATTCTTATCCTT
  4TTTCAAAATGAAGAATTTGTGATGGTTAGTGGACAGTTCAGAAGCCTCTC
  5TGCAAGAAAGGGGGCGCTGAGAAGTGGTAAAAAAAGGAAGGAAGCACTCG
  6GGCTTTGTCAGCAGGGTGGACCCTGGGGTCCACAGTGGGAACAGTCCCTT
  7CTGGCCTCTACTCACTGACCAAACGCTTTACTAAAACTCCGCTTCTGGCC
  8TCTGTTGCCACCTCCTGGTCGCTGTCCTCGGAAGTTTCTACTTCCTCCTC
  9GCT
 10>mm9_chr10_75372919_75373002_+
 11GCGTCTCGCAGCTTCTGCCCGTCGATCTCCATGTCGAGCCGGATGGGCAC
 12CAGCACCTCAGGCTGTGACGCATTCTCATGGATC
 13>mm9_chr10_80362428_80363292_-
 14ATGACGGACAAGTGTTTCCGGAAGTGCATCGGGAAGCCCGGGGGCTCCTT
 15GGATAACTCGGAGCAGGTGAGACATCTCGGGAACCCGGGGTGGTGAGGGG
 16CGCGGGGTCAGGAGCGTCTAGGAGGTTGAGAGATGTGCGCGTGCGCGGCC
 17TCTAGCCTTAGCTACTGAGGAAGTTGTGCGCGTGCGCGGGGTGAGGACCC
 18GGCTTCTGTGCCTAGATCGGTGCAGCCTTCATGGGTGATCCTCGGGTCGT
 19GTGACCGTCAGTCAGGGATCCCCCTCCACGCTTTGCAGAAATGCATCGCC
 20ATGTGCATGGACCGCTACATGGACGCCTGGAATACCGTGTCCCGCGCCTA
 21CAACTCTCGACTGCAGCGGGAACGAGCCAACATGTGACCGGGACCTGTGC
 22CTCGGGACACCGTGCTTATGGTCTGAACTGTTTTCCCTGCCAGTTAGGGT
 23GTCTCCTCCTAGCCGCCCTGAAGTCTGGCAGCATGGAGGGCTTGGGGATC
 24GAGGCCTCTCCCCTGGGTTGCTGCGTCCAGCTCAATCTCAGAAGAGAGTG
 25AGGACCCGACAGAGCACAGGGATCTGGCTGGCCCCACTGACCTGTGACCT
 26CAGGAGAGCAGGCCAATAAATCGCTGCTGGGGCAGTAAAGCAGGCGTGTC
 27ACCTCACTGCTTCAGGTCCCTTCCCCTGAGTAGGCCCAGACCTCCCAGGG
 28TATCTTTCCCCTTGGGGTCAGTGGGCTGCTGGCTCTCAGGGAATTCGGAG
 29CATGATCTCAGGTGTTTGGTCATCCCGGGGAGACCAGCCGAGGTTAAGAA
 30GCAAGGCTTCATGTagccttcacctatcatgcatgaggcccagggtgctg
 31accttaactctgaat
 32>mm9_chr11_7904565_7904642_+
 33CATCTTCTATTTGAGCCTCCATCCAGGCACCTCTGAAACAAAGGTGCACT
 34CACTGCATGTCCACTTGTCACAGGAGCC
 35>mm9_chr11_78140156_78140259_+
 36CTGCTTGCTAATTTTCTCTCTTGGGATCAGGGGGACGTGAACTCCAGCCC
 37TGACTCGTGCTCCTTATGCTCTGAGTACATAGCAAATAAATGAGAGCAAA
 38ACAC
 39>mm9_chr11_105616462_105616737_+
 40TAGGTGTAATAGTGGAAAACAATAGTTTTTAAACTTCAGAGTCCAGGGCT
 41GTAACTCAGTAGTAACAGTGTTCTCTAAGTATGTTATTCTTCCTCTACAT
 42GCTGAAATTTTTCATATTTGGAGCATTCACTGTTCCATGTATCAGTAAAT
 43TATATTGTGAGCTGTCATCATATCTAAGCACCATATTGAATATTTTTCAT
 44GATTAAAATTTGTTGAAACAACAATTCTATGACCGAAAAAAGCAAGGCTT
 45TGTAAATAACATGTTTGTTACTAGTA
 46>mm9_chr12_30701762_30702509_+
 47TGTGGAGTGTACTTATATGATCCCTATGCTGATAGGATTACCTTCCTAGA
 48CATAGCTAGACGCAAAGCCACATGTGTAAGGCTGCTGAGCAAAGACAGCA
 49TCCCAGCATGGGTGTGTTCACGGTGGATTCACCACGTTGCATATGTAAAG
 50TGGTCCCCTTGGCTTACCCTTCACTTTGCTCATGAGATTCAGAAGCTGGT
 51GGTCCAGCAGGGGTGAGCATTTGTGAAATAGTAAGCTGAACTTAGTGGTG
 52AGATTTCAGAACAGACTTCTGTGAAGTAAGAGATGTAACCATGCATCTAA
 53AATCAGATGGCCGTGTAACTGCTCGGGCATAGAAATGGTGGGAGAACCTG
 54TCCTGGGTACCTGGCATTTCACATGAGCCCAGGGATATGTCTTGTGCCAA
 55GGCACACAAGTGTCCATGGACTTGGACAGGTGCCAAGGGTTTTTGTCTCT
 56GTTCCTATGTGGGAGGCTGGCTGTGATTTACATTAATTTCTGTATTTCAA
 57ACGAAGATGTCTGCAGATCTCCATTTTGATGTTACAGCCTCATTGCCCAG
 58GCAGTGGGCAGTGCCCAGACACCCTTTCTGACTAGCCACTGCATTGGGCT
 59TCTGTGATTCAAAGTAGTGTATATATTTATTTACTTCTCTGACTGTGGCC
 60AACAGCCAAATGCCATTTTATGTTCCTTGTATTCAGTCCATTACCAAAGA
 61GGTGTTTGCACTTTGTAATGATACCTTTCAGTTCAAATAAAAGGACCA
 62>mm9_chr13_49159496_49159569_+
 63ttttcttttggattacttgatttttttttatttgatcttatttatgatga
 64ttttgagtacatttttgaacagtt
 65>mm9_chr13_100200304_100200330_+
 66TCTCATATGAATAGCCACCCTCTTCTG
 67>mm9_chr14_31949103_31949152_+
 68GGATGCTATCCGCGATGTGCATGTAAAGGGCCTCATGTACCAGTGGATCG
 69>mm9_chr14_67604227_67604668_+
 70TTCACCGTGAGAGTTTTCTCCATTTCACTCTTCACTGTGCTGTTCTCTGT
 71GCCGCTTTCCTCTTGACTTATAAACATCTGAGCCAGTTTTCAATAAACTT
 72AAAACGAAGCCTGCTTCTCATCCCAAATTGTAAACAGGAATAAAGCTTTT
 73TAAACCTTATCTTAAATTTTAACTTTGTTGAATTCTGCTTTGTGATAGGA
 74CAATCTGTTTCACCCAACAAGAATCTGTGTAGGAGGATGAACATCCCGCA
 75TGTTGGAGCTGCAAATCAGCACTGTACAAGCTCACTGATGGACAGCTGTT
 76CTGTGATGTATTCCATGATTTTACTAATACTTTCAAAAATGGCAAAACTA
 77ACTTCAGTTTTAATGTTGAAAGAAAATCATAAATGTTCCCATAGTTCAAT
 78GGCACTGTCGATGAAACTGCTACTGAATTTAGAGAGAAAACG
 79>mm9_chr14_75165582_75165744_+
 80ggccctgggatgataTAACAGAAGAGTCTAAAGGAGGCTTCTGAGATGTG
 81CAGTAGGAAAGCCTGGCACATAATAGGTTATTATCTAAATCCCTTCACTA
 82CTCTTCAAAGACAGCAGGATGCCTCTGCTCCCATGTTTTATCTCTACTTA
 83TGTGGAATTTATG
 84>mm9_chr16_57154027_57154067_+
 85GTTGAGGTTTATTTAAGTAAAATGATTTTTTAAAAAAGCAA
 86>mm9_chr16_74862302_74862560_+
 87GCATTGGCAGCAGATATTGGTACCCAGTGGCACTGCAGAGTACTTACAAT
 88CAGGACTCGCTACTGTGCTTCATTCTGCTTTTCTCTCTGCTTCTATTACA
 89GTTAAAGTGTTGCTAATTATAGAAACTCTCTGTTTATTGAACCTCGGTGT
 90TAAGAAAAACTTGTAATCTTCAGATATGATCCGAAAGATTCCCAAACAAA
 91TGTAACAAGGTCCACTTTTGTAGCCCTTTCTACCAGAAcactggttatca
 92acctgtggg
 93>mm9_chr16_98168779_98168914_+
 94CCTATTTATTTCACTAAACATCTGCCTGCTAGCTGAGATAAACATTCTCT
 95AAAAAACTGTTTACTGCAAAAAGTGATTACTGTTTTTTATTAGTTTCTTA
 96GCATTTGAAATAGTTACATGAATGGAAGGATAGAGT
 97>mm9_chr17_8483212_8483268_+
 98AGACTTGTCAACAGCTCACCCAATGATGGAACTGAGGCTGCCCCTCAAGT
 99GGCCAGA
100>mm9_chr17_30355791_30355913_+
101atctcatacccataagctcagaactcggggtggtaacataggaggactgc
102catgagtgtgactaacctgggctataggaggaggatctaccttaagcaaa
103tgaCCAACAAAACTAACAAGCTC
104>mm9_chr18_39571718_39571880_+
105TATAACATTCCATAAATGTACAATAATCTATTTTTGAGAAGCTCATTTTG
106AAACTTAACACTGTCATTGATAATCTTCAAGTGGTATTTCTTAGGCACCA
107TAAATTTCACATCCAGCTGGGTTACAATTATTTTAAAGTACTTTGAGACC
108AATTTAAACCATT
109>mm9_chr19_17633088_17633203_+
110TGGGAAATGAACTGCATGGCAATGAACCCCAGGGAATTTGGTGGTTAATT
111GTCTAAGGATAAGGACATCAGTTTTGTCTTTTGCATCACTGTGACCTTTG
112CCTCTAATTGTATAGA
113>mm9_chr19_41997624_41997859_+
114gctacacaacgactcacatagagggaagcaggcacacatcagataaaaca
115cAAAAGGATGGGTTGGTGATGGGCATAGTTAATGAGGGCCACTAGGTAAA
116TACACCTGATCCAAAAGTCACGCTACTACTTAGATTCTTCTCTCTGCTAA
117AGACAACAGAAgacatgttagccatgcttgtaatccctgcattggggaga
118tggagtcagaaatatcactgcaagttcacccaatag
119>mm9_chr19_56516515_56516684_+
120TGTATTCATTCACTATTCACTGATTTGTCAGATCATCCATCCACACAGGT
121GCTGAAGAGTAACCCATTTCACTTTGTATACAAGATAATGTTTTTGTACT
122TCAAATACATCTGGAATTCTTTCAAATATTCCAAGATTTTTTTTTTTTCT
123GAATAATCTTTGGTTACCTC
124>mm9_chr2_4543774_4543977_+
125gagccatttctccagccccTTTATGTGGAATATTAACAAGAGAAGACAAC
126ATAAAATGACTTACCATGCTGTGTGGCCTAACAGTGGATGAAGAATGAGT
127GATTTGGGCATTTCTGATAGTATTTATAAAGAAGACTTTTATGACCAAAC
128CACATGTCACAGTAGGGATTTGCTGCACATCTTATGAGAGTTTCTTCTTT
129GTCA
130>mm9_chr2_30200331_30200938_+
131CGCACACAAAGGATTTATTTGCCAGAGAGCAAGCAGACAGGCAGAGGTCA
132GAATGTTAGTTAGAAACTGAAGGAATGACTGCTGTAGCCACTGTGCCCAG
133CCAGAGCCATGAGGGAAGTGGGAGGCAGCACTTGGTGCTGCTGCTCTGGC
134TGACCCTTCTGGTTTCCTGCCACACTCCTAGCCCTGCCTGTGTGCTGCTG
135TCCCCCTCAACCTTCCACAGCCAGAAGGCAGATGTTCTTTCATGCCAAGA
136GCATCCATCCCCAGCATATCCTGGGCCCATGGTGGTGTCAAATGTAGTGA
137CCCTTCTGCCTTAAGGGAGCTGGGAAGCCTGGGGTGTGCAGGGTTGCAGG
138TCAGAAGCAGGACTAGCAGAGGGGCCTGGGGCCATTCTGTCTTGTGGGCT
139CTTTAATAGCTGAATGACGGGCACAGCCAGAAAAGGGTTAGGTCCCTTAT
140CCTAAGCAGCTCTGTGGCCAGCAGACGACTCTAAGTGGCAGAGCCTGGGA
141AGGGGCTGCTTAGCTGAGAAGTTCCAGGTAGGTGACAGGAACCTTGCCCT
142TCTTGTTGCCTCTCTCACCAATGAGCCAGTCGGGATCCATGCCTGGCAGG
143CTGTAGAC
144>mm9_chr2_106644220_106644341_+
145attcttaaggtaaatacctaggagtgatgtaacccagtcatagggaagaa
146ctacttttaatttgttgagcaacccccaacctgattttgacacaggtttg
147agtagtttacacttctactaac
148>mm9_chr2_125388931_125389219_+
149AGAGCACACAGCACATCACTTAGGCCTCCAACATTAAGGCAGCGCAAGTG
150CCTCAAGTAACTGAGAATACTTTACTCAGATACAAGGGTATCAAAAACAT
151GAGAACTGGCAGGAAGACCTCACAATGGTTTGTTAGCATCAAGTATTACC
152ATCCAGTTTCCTGTTTAAATAGTAATTAATGACTATTCTGAAATAAGGCA
153AATAATTACTCAAGCGGGCTGTCAAAGCCACTATCCTGTTGGCTGGGCAT
154CGGAGCAGTTAACTTTATCAAAGGCTTCTGACACAATGA
155>mm9_chr3_130936639_130936898_+
156CGAGGCTGCAGGCTGCAAATGTTCCCAGGCAGGCAAGACCTCACGTCCTA
157CTGGCTGCTGCCCTTGGGTGCATCTGTAGGCCCCGTGGCTCCTGCCCCTG
158GGGTTCAACACCGATAAACATAGAATACTCATTTTCAGAAGACCTGAGGG
159AATGAGTCTAAGCAACGCTTTTTACAAAAAGTGGCAAGGTTCAGGAAAAA
160AAAAAAAAAAGATGTTGCTCCAAGGCACCAAGGGTGTAATTTTTTTTCAG
161AAAAAGTCAG
162>mm9_chr3_136592671_136592771_+
163TGTCAGCCCATCACATTTTAGTGACAACAGTCATAGCCTTTATTTTCAGA
164TGACTTTCCTCTAAAACCACTGTCTATGAGTTGCCCCCCAAAACTCAAAA
165A
166>mm9_chr3_152861374_152861508_+
167ATCAAAAGCGACATGCAAGCATCTTGCTCTCACCACAGATCACTGAGACA
168TTAAGAGTGACGTCTCTTGAACTGTTGGCACGCCTAAGTTATTTCAGCAT
169TTCTTGCTCAGCAGTTGTTCTCTTGGCTTCCTCTG
170>mm9_chr4_13715310_13715630_+
171AACACATGGCCACATCATGTGATATTTTCAAAACACTTACACATAGCTTT
172GAGAAGGTCCCTGCAGGAATGATCCATCCTCTCACAGTTGGCCCATTTTT
173TAACAGCATATCTGCATTTTCCATTTAGGAGAGCTATATATTATTAGCTT
174ACATTTTTGGGTAGTAAAACAGTGCATTGCTGATTGTAAAACATGGACTT
175TATTATCTGCTGAAAATTGATTTGGCATTTATAGCCACTGTGTATTAGAC
176TGTTTTTCTGTTTTTAACATCAATGCTTAAAAGCGATGATTTGTGTTTaa
177aaaaattaaaaaaataaaata
178>mm9_chr4_147515029_147515097_+
179GCTGACGTGCTCTCCGAGTTCCTGGAGGTGGCCGTGCACCTGATTCTCTA
180TGTGCGCGAGGTCTACCCG
181>mm9_chr5_3949522_3949685_+
182AGTCCCAACCACCCCCTTGTTTAATGTATAACTTTCTGAAATGGGAGCGT
183TAGAATGGATTAAAATGGTTGGTAGGTGGTTGGATCACCAACCAAGACCA
184GAAATAGAGGGGTAGGCTGCTCAGGAGAGTATTGGGAGGGTAGCTATTAT
185TTGCATTTTGTGCT
186>mm9_chr5_68089694_68089831_+
187CAATGATAGAGAAGACTAAAATAAAAGCAGGCATGCTGGCACAAGCGACA
188GAAGGAAAAAGCCTCACCCGGCCCTGTTTGAGGCCACTCCTGGTGGCTCC
189TTTTCCAAGGACCATGCGGTCAAGCCTCTGAGTTGTTC
190>mm9_chr5_122819526_122819619_+
191CTTTAGAAAAGATGCATCTGTCATTGATTTAGGGATATGAATTGTTTGGA
192TTTGAGTAGTTTTCCATAACTCCTGCAGTTTGGCAATGTGTGCG
193>mm9_chr5_145619548_145619710_+
194CGGCGTTCTGAAAACTGTGCTCCGGGATGAGATCATTGCTTGGCACAAAA
195AGACACAGGAGGACACTTCCTCTCCACTGTCGGCCGCAGGGCAGCCTGAG
196AACATGGACAGCCAGCAGCTGGTTTCCTTAGTTCAGAAAGCCGTCACTGC
197CATCATGACCCGC
198>mm9_chr6_83928984_83929105_+
199ACAGGAACCATTATTTACATTTAATTTGGATGAATTTGTTACTGTGGATG
200AAGTCATAGAAGAAGTAAATCCTTCTCAAGCCAAGCAGAATCCATTAAAA
201GGAAAAAGAAAGGAAGCCCTCA
202>mm9_chr6_118857949_118858148_+
203CCAGGCTTGCTAGTTGGTGCAGTTAGCTACATCTCAGGACAGAGACAAGG
204TACTCTGAGCTCCCCTTGAACTGCCACACAAGCTGTCTCCTGGATGCCAA
205GCAGAGAAACCTGGAGACAACAATCATCATACTCAAAACCAGGATCTCTT
206TCTTAAGACTTTTGTATTTTGTCCCAGCCCTAACCCTGAGTTCTGCTGAA
207>mm9_chr7_85554210_85554343_+
208GTGAAACATCATGCTTCTGCATCAAGTTATTAGTGGGAAACCTGTAAAAG
209TTGACATTGAATGCTGATAACAAATTACTTTCATCCTGTCTCATAATGAA
210TCCTACATCAAGACAAGGCAAGTGAGAAAGAGGG
211>mm9_chr7_104055491_104055589_+
212ACATTTCTCCTCTCTTGGGGGAGCGCATCTCCTTGGGTGTGTCCACATCC
213GCCCCTAGGTACCCAGTGTGATGTGAGACACGAGTGTCTGTGCTAACTT
214>mm9_chr8_9970398_9970545_+
215AGTCTTCACCAAAATTAAGTCTCAGCTAACTTAAAAGTTGCAAGGATTTT
216TTTCAATAAAATTAATATCTTAAGTGTTTGGTGTTTAGATGATTCTCTCT
217CAACTTCCCCCACATTATCAAAAAACATTTGATGAACCTTAAAAACTC
218>mm9_chr9_20449846_20449932_+
219CCAGCACCGATGACACCATCGGCGACTTGAAGAAACTGATAGCTGCTCAA
220ACTGGCACCCGCTGGAACAAGATCGTTCTTAAAAAGT
221>mm9_chr9_107445870_107445930_+
222CAAGCAGAAGCTGGTGCCCATCATGACCATCCTGCTGGAAGAGCTGAATG
223CCTCCGGCCGC
224>mm9_chr9_120860476_120860606_+
225CTGCCATTGTACGCACCATGCAGAATACAAATGATGTAGAGACAGCTCGT
226TGTACTGCTGGGACTCTGCACAACCTTTCTCACCACCGCGAGGGCTTGCT
227GGCCATCTTTAAGTCTGGTGGCATCCCAGCG
228>mm9_chrX_10274057_10274087_+
229ACTTCGCTGTCATCATTTGTACAAACTCTTT
230>mm9_chrX_39881431_39881678_+
231AGCTAAAAAGAGTCCTTTTCTGACAGAAAGGCTGGACTTCTCCTTTTCAC
232CGTTTCTCTTACTGATGCTTTTGCCAGAAGAACAGTAAAGATTTAGACAC
233TGTCATGATTCATACACGTAAAATATTTTTCAAGGACACAATCTGATATA
234CTAACATTTATTTAAGAGGTTAAAGTCCACCACTAAATCTAAGGAAAGAT
235TTTTAACTGCCAAACACATTTCCTTTGACAAATAATGTAAGATGACAA
236>mm9_chrX_148249672_148249713_+
237AATGCTAGTATGAACAGTGGGAGGAATGAGCAAAATGTTACA
238>mm9_chrX_148481505_148482455_+
239CGCCACAACCTGCTACAGGCCTGTAAGATGCAGGACATCAAACTGCCACT
240GTCAAAGGGCACCATGGATGATATTAGTCAGGAAGAAGTGAGTATTATGG
241TGGGTGGTAGGAGTCATCTATGAATATTTAACCAGTAATGGGAGATTACA
242GATGGCCAGGAAGGGCAGGCAACAGATAGGACCACATAGAGTTGTGAGGG
243GCATAAAGATGGATGCAGAAGAAATGTGGCAAGGTGGAAGTAGTGAAGTC
244AGGCTTTGGTATGAGAGAGACATTGATTTGAGAGGAGAGCTGCAAGCCAG
245TGAGTACTCAGAAAGACCAAGAATGGGTCATTAATCTTAAGGATTTGAGC
246TCTTAGCTGCAGCAGATACTGGGCATGGGTAGGAGTGAGAATTGAGGAGC
247AGAGGAAGATGGGAAACTGGAGAACCTAAGGAGACTGATAGCTTAGCTGC
248AGTAAGGGAGGTTGGCCAGAAGAGGGTTGGGTAGGGGACTCAGCAAGGCA
249GAACTAAGGAAGCTTAGGTGGAGGGGAAGGAACAACATCTGAGCAACTAA
250AGCACTCTATCAACTGGAAGTGCAAGATGGTAGTGAGGGGTGGACAGGTG
251TAACTGAGTAACTCTTTGTAGGTAGCCTTTCAGTTTAATTCAGTAAAATA
252TTTTGAACACTAGTATTCCAGATACTGGTAGGCCATGACTTAACCATTCC
253TAATGTTAATCTCAGCTGTGCTAGCTGAGCTTGTGTTCACATTAGACATG
254AAGAAACTTAGTAAAAGGTAGAGCCCAGTTTTCGGTTTGGACCTTCCTGT
255TGGCCTCTGCTTCCGTGCCATCTAGCAAAGGAGTTCCTAATCTCTAGAGG
256GATACAAATGACTAGTCTGCTCCATCTGCCTCTTCCAACATTGCAGGGTA
257GCTCCCAGGGAGAAGAGTCAGTGAGTGGTTCCCAGAGAACATCCAGTATC
258T