PageRenderTime 20ms CodeModel.GetById 15ms app.highlight 1ms RepoModel.GetById 1ms app.codeStats 0ms

/test-data/lastz_paired_input3.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 2 lines | 2 code | 0 blank | 0 comment | 0 complexity | 35b5a3ee8903be0ec1ff6f0205cea0da MD5 | raw file
1>linker
2TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG