PageRenderTime 24ms CodeModel.GetById 19ms app.highlight 2ms RepoModel.GetById 1ms app.codeStats 0ms

/test-data/rgClustal_testout.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 48 lines | 48 code | 0 blank | 0 comment | 0 complexity | 7d05ceac2daeb991b15f82cf9a3b3200 MD5 | raw file
 1>c_briggsae-chrII_+_
 2---ATGAGCTTCCACAAAAGCATGAGCTTT
 3CTCAGCTTCTGCCACATCAGCATTCAAATG
 4ATC
 5>c_brenneri-Cbre_Contig60_+_
 6---ATGAGCCTCCACAACAGCATGATTTTT
 7CTCGGCTTCCGCCACATCCGCATTCAAATG
 8ATC
 9>c_remanei-Crem_Contig172_-_
10---ATGAGCCTCTACAACCGCATGATTCTT
11TTCAGCCTCTGCCACGTCCGCATTCAAATG
12CTC
13>c_elegans-II_+_
14---ATGAGCCTCTACTACAGCATGATTCTT
15CTCAGCTTCTGCAACGTCAGCATTCAGATG
16ATC
17>c_briggsae-chrII_+_bar
18---CCGGAGTCGATCCCTGAAT--------
19------------------------------
20---
21>c_brenneri-Cbre_Contig60fee_+_
22---ACGAAGTCGATCCCTGAAA--------
23-TCAGATGAGCGGTTGACCA---GAGAACA
24ACC
25>c_remanei-Crem_Contig172zot_-_
26---ACGAAGTCGGTCCCTATAAGGTATGAT
27TTTATATGA----TGTACCATAAGGAAATA
28GTC
29>c_elegans-II_+_meh
30---ACGAAGTCGGTCCCTGAAC--AATTAT
31TT----TGA----TATA---GAAAGAAACG
32GTA
33>c_briggsae-chrIfooI_+_
34CGCACAAATATGATGCACAAATCCACAACC
35TAAAGCATCTCCGATAACGTTGACCGAAGT
36---
37>c_brenneri-Cbre_Contig60gak_+_
38CGCACAAATGTAGTGGACAAATCCGCATCC
39CAAAGCGTCTCCGATAACATTTACCGAAGT
40---
41>c_remanei-Crem_Contig172foo_-_
42AGCACAAATGTAATGAACGAATCCGCATCC
43CAACGCATCGCCAATCACATTCACAGATGT
44---
45>c_elegans-II_+_more
46TGCACAAATGTGATGAACGAATCCACATCC
47CAATGCATCACCGATCACATTGACAGATGT
48---