PageRenderTime 11ms CodeModel.GetById 1ms app.highlight 3ms RepoModel.GetById 2ms app.codeStats 0ms

/test-data/fasta_formatter1.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 100 lines | 100 code | 0 blank | 0 comment | 0 complexity | 6cbc8a7b8a5b699e12ef2f23b125b642 MD5 | raw file
  1>Scaffold3648
  2AGGAATGATGACTACAATGATCAACTTAACCTATCTATTTAATTTAGTTC
  3CCTAATGTCAGGGACCTACCTGTTTTTGTTATGTTTGGGTTTTGTTGTTG
  4TTGTTTTTTTAATCTGAAGGTATTGTGCATTATATGACCTGTAATACACA
  5GTATAACTTTTCAAATACTTTTGTTTTACAACTTTTCTCTCTGGACTTAT
  6ATTAAAGTCAATTTTAATGAACATGTAGTAAAAACTAATACATGTACATC
  7TACAGTTTATTTATTTTTTTCTTCTTCTTTTTGTATTTCTTGTGTTACAT
  8TATTTCACTTCACGTTCATGTTACCAACCTTGCCCCCTTGCTTTCCATGC
  9AAAAAAAGAAAAAAAAGAAGCAATACTTACACTTACCCTTGAGATATCTT
 10GATCTGAATGCTTTAACATTCTATATGTACAATAAATTTTTGTATCTATA
 11GCCTATTATTATATATGTTGCTATGTCAGGCACATTGACAACATTCTCAG
 12AAGGTTAGAAGATGGTATTGTTCTGAAATGCCTGGAATGCCTTGTGAACT
 13AAGATGATTACTCATGTCATTAAAGTCCCCTAACCCAGGTATTTCCTCCT
 14TCCCATGACGAAAACAGTCCATTTAAACTTCACCCCACTTTGGACCCGAA
 15AGTGGGGTGCATTTTGGTGGTAAGCTCACCACAGAGCAAGAGAGAGTTAG
 16AGTCCCTAATCTGCAGTGTAAACAAACTTTGCCAGGACATCACCAGCCCA
 17ACCTTGATAAGTACTGCTTGGAACTCCTCCATGATGTTCTAGTCTTATTC
 18GCAGTCTCATATAGGTTCGGATTTTGTCCATTCTCATAGCTACCAGTATA
 19CATGGGAGATGCCAGTTTCATCTTCCTTGCTTCACTTTATAAGCATAGTT
 20ATATCANGAACTTCCTGGTTATAATTATGTTCCTTTCAAGTTTCATCATA
 21ATTGTCTAGTTCGATATAGTACATGGACACAATTAAATATGATATTGTCT
 22>Scaffold9299
 23CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAG
 24TCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAG
 25GAAAAGCATCCTTGTTTGTTTCACTATGCTTTTTAATGGTTGACGTTAAa
 26ggtaaagaccagtattggaaacgccccaatttcaaaaaatgaaatggaag
 27ctctcattaccaatcatgtgaaagaatatgttttgactaatacatgatga
 28taaaaaaattgccgggaaaccgcctactaattcatatatttagtaaattt
 29gtttctctcatggtctgtgagagatatagggtagtcccatatacatcttt
 30ctgtgtatagtgcttgtaactttacgaagaatgggccaaatttcttatca
 31ttttgatgattccagaaccttgcagatgcgagatggtagatgatcaacct
 32tttctgatcgattccataacgtttctttcacaatgcaatcgcatgaccat
 33aactggtctttacctTTAAGTTGTAGGTCTTAATTGATAACACTATATAG
 34TTTTTTTCTTTTTACTGTTTTTATTAATGACCTCTGTAATTTGCCCTATT
 35GTGAAAATACTAAAATATGTTTATACGCCGATGATGCGGCAATATTTTGC
 36CAAGGCAAAGAAATTGCCCTTGTTGAGAAAACTCTTAAATGTGAGTTTAA
 37AAAAATAGTTGATCACATTGAAAAAGATGACTTAATGTTGAATATCAAGA
 38AGTGTAAGATCATGTTATTTGGGACAAGAAAACGAATCAAAAATCAAAGT
 39GTACGCTTGATTTACAGAGATAATGTTATCGAAGTTGTAAATGAATTTAA
 40ATATCTTGGTGTATTATTTGATAATTATTTAAAGTGGGATATACATATAT
 41CGAAAACTGCCTCCAAAATATCTAGAACCATATCATGTATAAAACGAATT
 42AAATATTATTTGCCGAAAAGAATTTTAAAATTGTTATATGATAGTTTGAT
 43ATTGTCACATATTGACTACGGTATTGTTTTGTGGGGATGTTCAGCAAAGT
 44GTCATTTGGAAAAGTTACAAAAGTTACAAAATCGTTATGCCCGTTTAATA
 45CTAAACGTAGATATTTTGACACCTCGTATTATATTATTATCCTCTCTAAG
 46ATGGCAATCAGTTGTTCAGAGAGTGCAATACCAA
 47>Scaffold9309
 48GAAGGAAGAAGAGGAAAATAATGATGAATTTGTAGAATTTCTATAACGTA
 49TGAAAACATAAACAACATGAAAAAGTATGAACCGACAGAAGAATGAAAAT
 50TTCAATCATATAACATGTCATTCACTTCTCTTCTCTGACTGTCAAGTATT
 51AGGTATTCCTTTTTATTTCCTCTTAAAATGATCATAGTTTCCTATTTCTT
 52TTACACCATTGGGAAGGGAATTCCAATGTTTTATGGCATTGTAATAAAAC
 53GAATTTCCAATACTACCTACTCTTTCTGGTAAGTTAAAGTTGAATCGGCT
 54ATTTCTTGTATTATAATCATGTACGTCAGTAACAAGATCGAAGTTGGATC
 55GAATATAATGATTCGACCTAGTATGATATATTTTATGCACGTGATGCAAT
 56ACGAGTTGTTTTGATCTTTGGTCGACTTCAAGAAAACCAGCTTTAGAAAG
 57TTCGCTGTAGCCAACATGAGTTCTTGCCTTGGACTAGAACAGTTGATAAA
 58TCTCACCATTTTGTTCTTTAAGATGGGTAGAAGAATCCCTGCAATCTAAA
 59TGGTCAATTACTGTGAAGTTATTTTTACTGGATGCACCCAATAttttttt
 60gataatttttttttctttgataatttttttctttttctttaataaatttt
 61ttggataatttttttttggataaatagttcttttttgataattctaataa
 62tttttttatttattttttttttttctataattttttttaaaaaatttatt
 63aatttttaattaaaaaaaaaataaGAGTTAACAGATTAAGGGAAACTGAC
 64AATTCAAAAAAAAAAAAAA
 65>Scaffold9310
 66GCGGGGGCTGGGGAGGAAGGGGTGGCGTTATTTCACTTCCGATCTAATAC
 67GCTTTCTTAAGACACTGAAATATCAGTAGGTATTGGTATAGAGAATTACT
 68TTTTATTTTTAATTAAAACATTATCGAAATGAAGATACAGAGAAAAACGA
 69TGAGATGTAAGAAGTGCGCGTATTTAtgtgtgtgggtgcgtgtgtgtgtg
 70tgtgtgtgtgttgtgtgcgtgcgtgtgtgtggtggtgtgtACTAATTTTG
 71ATGTGTGTTGTGGCACAATTGCAATCATCAGTATCTTCATGAAAATGATA
 72ACCAGAAGCACAAAAAGGAGGgtgcgtgtgtgtgtgtgtgtgtttagtgt
 73gcgtgcgtgtgagggtgtttaagtgtgtatgtCGGAAATGTGGCACAATT
 74GCAATCATCTGTATCTTCATGAAAATGATAACCAGAAGAACAAAAAAAAA
 75AAACATTGAGAGAACATGTTTTTTTGATGGAAGACAAGAAGTTCTCGTAA
 76CGTAGGATCTCCGAGACATGATGGGGTCAACTTAAAAAGAGAGCAGTGAG
 77AGGCATTTATATCGAAGGTCAGGGAAAGGCAAACAAAGAAAGAAAAAAAA
 78AAGGCTCACAGGAGAACGAAAACACGGGCCAAAATAATAAACAGGAGCAA
 79GTGAACGGGCAGTTTGGTAGCTACTTCATTTACCGGCTTTTAAaggtact
 80atgtcccatttgcaggtcaaaaaaaatgaaaaagttaaattccaactgca
 81tttgaaagataatactaatttacaacttccctaaaaaaggtggggcttga
 82aaatgtcttcaagtgcggaaaataacgactattagttgtcaaatcgactt
 83tagggCTATAGAGCCCAAAAGTAATAGTCTTGA
 84>Scaffold11911
 85TTCTTGGCACCCCCCCCCCCCCCACACTCCTGCACTGAAGAACTACTCAA
 86GTTTAAACTTTGCATTGCTTTTCTTTCTTTTTCAGTATTTTTTGCTTGGT
 87ACATGTTTCTCTTAATATCTGTCGTATAGatttttaatatttttatttat
 88atCTACGTCAATCTGGCTGttctttttcttgtcttctttttttttctctc
 89tcttttttttcctcgtattttGTATTGATCCTTACCCTAGTTTTTGAACT
 90TGAACAGCAATTTGCAGCACTCAAATTTCTTTAAAATTACCTTCTCTTAT
 91TTGtctctgttcccctctccccccctctctctctctctctctctctctct
 92ctctctctctttcATCTCCCATATCATAATTTGAAGTACCATCTATGGTG
 93TTTTCAGATTGATCTTTCTTGCTTTCCCCACCCTCCCCCTTTATGCAGTT
 94AATTTTCAGTCTATTTGTGTTTTCTGTGGTTGATTCTAATCATATTCTAA
 95CTCTTATTTTACATTTTACTTCACTAACAACTGGTTTATTATATTTGTTA
 96CTAATTTTGAATTAAACTATTTACCATTCTGAACGAACTGAAAGATTAAA
 97GATCAAACTATCTATGAATAGAATGGTATTTCTTCAATTTATTCAAATTT
 98CTCTCTCTTTAACCCCCTTTTTCTGCTTGCATTTTTATCCCTTTGCCGTG
 99GACTTCACTGGATATTTTGCTTTGATGCCAATCCAACAATTTTGCATATA
100TTA