PageRenderTime 22ms CodeModel.GetById 2ms app.highlight 13ms RepoModel.GetById 1ms app.codeStats 1ms

/test-data/picard_output_alignment_summary_metrics.html

https://bitbucket.org/cistrome/cistrome-harvard/
HTML | 64 lines | 59 code | 5 blank | 0 comment | 0 complexity | 59279dd5292b7f477ffc54aed156995f MD5 | raw file
 1<style type="text/css">
 2        tr.d0 td {background-color: oldlace; color: black;}
 3        tr.d1 td {background-color: aliceblue; color: black;}
 4        </style><?xml version="1.0" encoding="utf-8" ?>
 5<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
 6<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
 7<head>
 8<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
 9<meta name="generator" content="Galaxy picard_wrapper tool output - see http://getgalaxy.org/" />
10<title></title>
11<link rel="stylesheet" href="/static/style/base.css" type="text/css" />
12</head>
13<body>
14<div class="document">
15Galaxy tool CollectAlignmentSummaryMetrics run at 11/05/2011 23:16:24</b><br/><b>The following output files were created (click the filename to view/download a copy):</b><hr/><table>
16<tr><td><a href="CollectAlignmentSummaryMetrics.log">CollectAlignmentSummaryMetrics.log</a></td></tr>
17<tr><td><a href="CollectAlignmentSummaryMetrics.metrics.txt">CollectAlignmentSummaryMetrics.metrics.txt</a></td></tr>
18</table><p/>
19<b>Picard on line resources</b><ul>
20<li><a href="http://picard.sourceforge.net/index.shtml">Click here for Picard Documentation</a></li>
21<li><a href="http://picard.sourceforge.net/picard-metric-definitions.shtml">Click here for Picard Metrics definitions</a></li></ul><hr/>
22<b>Picard output (transposed to make it easier to see)</b><hr/>
23<table cellpadding="3" >
24<tr class="d0"><td colspan="2">## net.sf.picard.metrics.StringHeader</td></tr><tr class="d1"><td colspan="2"># net.sf.picard.analysis.CollectAlignmentSummaryMetrics MAX_INSERT_SIZE=100000 ADAPTER_SEQUENCE=[AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG, IS_BISULFITE_SEQUENCED=false] INPUT=/export/tmp/tmp1-mt_l/database/files/000/dataset_2.dat OUTPUT=/udd/rerla/galaxy-central/database/job_working_directory/3/dataset_3_files/CollectAlignmentSummaryMetrics.metrics.txt REFERENCE_SEQUENCE=/udd/rerla/galaxy-central/database/job_working_directory/3/dataset_3_files/CollectAlignmentSummaryMetricsZJS8q6.fasta_fake.fasta ASSUME_SORTED=true TMP_DIR=/tmp VALIDATION_STRINGENCY=LENIENT    IS_BISULFITE_SEQUENCED=false STOP_AFTER=0 VERBOSITY=INFO QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false</td></tr><tr class="d0"><td colspan="2">## net.sf.picard.metrics.StringHeader</td></tr><tr class="d1"><td colspan="2"># Started on: Wed May 11 23:16:24 EDT 2011</td></tr><tr class="d0"><td colspan="2">## METRICS CLASS	net.sf.picard.analysis.AlignmentSummaryMetrics</td></tr><tr class="d0"><td>CATEGORY</td><td>FIRST_OF_PAIR&nbsp;</td></tr>
25<tr class="d1"><td>TOTAL_READS</td><td>4&nbsp;</td></tr>
26<tr class="d0"><td>PF_READS</td><td>4&nbsp;</td></tr>
27<tr class="d1"><td>PCT_PF_READS</td><td>1&nbsp;</td></tr>
28<tr class="d0"><td>PF_NOISE_READS</td><td>0&nbsp;</td></tr>
29<tr class="d1"><td>PF_READS_ALIGNED</td><td>4&nbsp;</td></tr>
30<tr class="d0"><td>PCT_PF_READS_ALIGNED</td><td>1&nbsp;</td></tr>
31<tr class="d1"><td>PF_HQ_ALIGNED_READS</td><td>4&nbsp;</td></tr>
32<tr class="d0"><td>PF_HQ_ALIGNED_BASES</td><td>404&nbsp;</td></tr>
33<tr class="d1"><td>PF_HQ_ALIGNED_Q20_BASES</td><td>28&nbsp;</td></tr>
34<tr class="d0"><td>PF_HQ_MEDIAN_MISMATCHES</td><td>78&nbsp;</td></tr>
35<tr class="d1"><td>PF_HQ_ERROR_RATE</td><td>0.777228&nbsp;</td></tr>
36<tr class="d0"><td>MEAN_READ_LENGTH</td><td>101&nbsp;</td></tr>
37<tr class="d1"><td>READS_ALIGNED_IN_PAIRS</td><td>3&nbsp;</td></tr>
38<tr class="d0"><td>PCT_READS_ALIGNED_IN_PAIRS</td><td>0.75&nbsp;</td></tr>
39<tr class="d1"><td>BAD_CYCLES</td><td>63&nbsp;</td></tr>
40<tr class="d0"><td>STRAND_BALANCE</td><td>0.25&nbsp;</td></tr>
41<tr class="d1"><td>PCT_CHIMERAS</td><td>0&nbsp;</td></tr>
42<tr class="d0"><td>PCT_ADAPTER
43</td><td>0
44&nbsp;</td></tr>
45</table>
46<b>Picard Tool Run Log</b><hr/>
47<pre>Wed, 11 May 2011 23:16:24 INFO
48 ## executing java -Xmx2g -jar /udd/rerla/galaxy-central/tool-data/shared/jars/CreateSequenceDictionary.jar REFERENCE=/tmp/CollectAlignmentSummaryMetricsZJS8q6.fasta OUTPUT=/tmp/CollectAlignmentSummaryMetricsZJS8q6.dict URI=dataset_1.dat TRUNCATE_NAMES_AT_WHITESPACE=None returned status 0 and stderr: 
49[Wed May 11 23:16:24 EDT 2011] net.sf.picard.sam.CreateSequenceDictionary REFERENCE=/tmp/CollectAlignmentSummaryMetricsZJS8q6.fasta OUTPUT=/tmp/CollectAlignmentSummaryMetricsZJS8q6.dict URI=dataset_1.dat TRUNCATE_NAMES_AT_WHITESPACE=false    NUM_SEQUENCES=2147483647 TMP_DIR=/tmp/rerla VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
50[Wed May 11 23:16:24 EDT 2011] net.sf.picard.sam.CreateSequenceDictionary done.
51Runtime.totalMemory()=9109504
52
53
54Wed, 11 May 2011 23:16:24 INFO
55 ## executing java -Xmx2g -jar /udd/rerla/galaxy-central/tool-data/shared/jars/CollectAlignmentSummaryMetrics.jar VALIDATION_STRINGENCY=LENIENT ASSUME_SORTED=true  ADAPTER_SEQUENCE= IS_BISULFITE_SEQUENCED=false MAX_INSERT_SIZE=100000 OUTPUT=/udd/rerla/galaxy-central/database/job_working_directory/3/dataset_3_files/CollectAlignmentSummaryMetrics.metrics.txt R=/udd/rerla/galaxy-central/database/job_working_directory/3/dataset_3_files/CollectAlignmentSummaryMetricsZJS8q6.fasta_fake.fasta TMP_DIR=/tmp INPUT=/export/tmp/tmp1-mt_l/database/files/000/dataset_2.dat returned status 0 and stderr: 
56[Wed May 11 23:16:24 EDT 2011] net.sf.picard.analysis.CollectAlignmentSummaryMetrics MAX_INSERT_SIZE=100000 ADAPTER_SEQUENCE=[AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG, IS_BISULFITE_SEQUENCED=false] INPUT=/export/tmp/tmp1-mt_l/database/files/000/dataset_2.dat OUTPUT=/udd/rerla/galaxy-central/database/job_working_directory/3/dataset_3_files/CollectAlignmentSummaryMetrics.metrics.txt REFERENCE_SEQUENCE=/udd/rerla/galaxy-central/database/job_working_directory/3/dataset_3_files/CollectAlignmentSummaryMetricsZJS8q6.fasta_fake.fasta ASSUME_SORTED=true TMP_DIR=/tmp VALIDATION_STRINGENCY=LENIENT    IS_BISULFITE_SEQUENCED=false STOP_AFTER=0 VERBOSITY=INFO QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
57WARNING	2011-05-11 23:16:24	SinglePassSamProgram	File reports sort order 'queryname', assuming it's coordinate sorted anyway.
58[Wed May 11 23:16:24 EDT 2011] net.sf.picard.analysis.CollectAlignmentSummaryMetrics done.
59Runtime.totalMemory()=9109504
60
61
62</pre><hr/>The freely available <a href="http://picard.sourceforge.net/command-line-overview.shtml">Picard software</a> 
63generated all outputs reported here running as a <a href="http://getgalaxy.org">Galaxy</a> tool</div></body></html>
64