PageRenderTime 58ms CodeModel.GetById 28ms app.highlight 7ms RepoModel.GetById 2ms app.codeStats 0ms

/test-data/picard_input_hg18.trimmed.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 302 lines | 302 code | 0 blank | 0 comment | 0 complexity | 3138276e00fc2b54481d5b742bb02bc7 MD5 | raw file
  1>chrM
  2GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTT
  3CGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTC
  4GCAGTATCTGTCTTTGATTCCTGCCTCATTCTATTATTTATCGCACCTACGTTCAATATT
  5ACAGGCGAACATACCTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATA
  6ACAATTGAATGTCTGCACAGCCGCTTTCCACACAGACATCATAACAAAAAATTTCCACCA
  7AACCCCCCCCTCCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCAAACCCCAA
  8AAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTTTATCTTTAGGCGGTATGC
  9ACTTTTAACAGTCACCCCCCAACTAACACATTATTTTCCCCTCCCACTCCCATACTACTA
 10ATCTCATCAATACAACCCCCGCCCATCCTACCCAGCACACACACACCGCTGCTAACCCCA
 11TACCCCGAACCAACCAAACCCCAAAGACACCCCCCACAGTTTATGTAGCTTACCTCCTCA
 12AAGCAATACACTGAAAATGTTTAGACGGGCTCACATCACCCCATAAACAAATAGGTTTGG
 13TCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACACATGCAAGCATCCCCGTTCCAGTGA
 14GTTCACCCTCTAAATCACCACGATCAAAAGGGACAAGCATCAAGCACGCAGCAATGCAGC
 15TCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAAT
 16>chr1
 17AAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACC
 18GCGGTCACACGATTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTAGATCACCC
 19CCTCCCCAATAAAGCTAAAACTCACCTGAGTTGTAAAAAACTCCAGTTGACACAAAATAG
 20ACTACGAAAGTGGCTTTAACATATCTGAACACACAATAGCTAAGACCCAAACTGGGATTA
 21GATACCCCACTATGCTTAGCCCTAAACCTCAACAGTTAAATCAACAAAACTGCTCGCCAG
 22AACACTACGAGCCACAGCTTAAAACTCAAAGGACCTGGCGGTGCTTCATATCCCTCTAGA
 23GGAGCCTGTTCTGTAATCGATAAACCCCGATCAACCTCACCACCTCTTGCTCAGCCTATA
 24TACCGCCATCTTCAGCAAACCCTGATGAAGGCTACAAAGTAAGCGCAAGTACCCACGTAA
 25AGACGTTAGGTCAAGGTGTAGCCCATGAGGTGGCAAGAAATGGGCTACATTTTCTACCCC
 26AGAAAACTACGATAGCCCTTATGAAACTTAAGGGTCGAAGGTGGATTTAGCAGTAAACTG
 27AGAGTAGAGTGCTTAGTTGAACAGGGCCCTGAAGCGCGTACACACCGCCCGTCACCCTCC
 28>chr2
 29TCAAGTATACTTCAAAGGACATTTAACTAAAACCCCTACGCATTTATATAGAGGAGACAA
 30GTCGTAACATGGTAAGTGTACTGGAAAGTGCACTTGGACGAACCAGAGTGTAGCTTAACA
 31CAAAGCACCCAACTTACACTTAGGAGATTTCAACTTAACTTGACCGCTCTGAGCTAAACC
 32TAGCCCCAAACCCACTCCACCTTACTACCAGACAACCTTAGCCAAACCATTTACCCAAAT
 33AAAGTATAGGCGATAGAAATTGAAACCTGGCGCAATAGATATAGTACCGCAAGGGAAAGA
 34TGAAAAATTATAACCAAGCATAATATAGCAAGGACTAACCCCTATACCTTCTGCATAATG
 35AATTAACTAGAAATAACTTTGCAAGGAGAGCCAAAGCTAAGACCCCCGAAACCAGACGAG
 36CTACCTAAGAACAGCTAAAAGAGCACACCCGTCTATGTAGCAAAATAGTGGGAAGATTTA
 37TAGGTAGAGGCGACAAACCTACCGAGCCTGGTGATAGCTGGTTGTCCAAGATAGAATCTT
 38>chr3
 39AGTTCAACTTTAAATTTGCCCACAGAACCCTCTAAATCCCCTTGTAAATTTAACTGTTAG
 40TCCAAAGAGGAACAGCTCTTTGGACACTAGGAAAAAACCTTGTAGAGAGAGTAAAAAATT
 41TAACACCCATAGTAGGCCTAAAAGCAGCCACCAATTAAGAAAGCGTTCAAGCTCAACACC
 42CACTACCTAAAAAATCCCAAACATATAACTGAACTCCTCACACCCAATTGGACCAATCTA
 43TCACCCTATAGAAGAACTAATGTTAGTATAAGTAACATGAAAACATTCTCCTCCGCATAA
 44GCCTGCGTCAGATCAAAACACTGAACTGACAATTAACAGCCCAATATCTACAATCAACCA
 45ACAAGTCATTATTACCCTCACTGTCAACCCAACACAGGCATGCTCATAAGGAAAGGTTAA
 46AAAAAGTAAAAGGAACTCGGCAAACCTTACCCCGCCTGTTTACCAAAAACATCACCTCTA
 47GCATCACCAGTATTAGAGGCACCGCCTGCCCAGTGACACATGTTTAACGGCCGCGGTACC
 48CTAACCGTGCAaaggtagcataatcacttgttccttaaatagggacctgtatgaatggct
 49ccacgagggttcagctgtctcttacttttaaccagtgaaattgacctgcccgtgaagagg
 50cgggcatgacacagcaagacgagaagaccctatggagctttaatttaTTAATGCAAACAG
 51TACCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCATTAAAAATTTCGGTTGGGGC
 52GACCTCGGAGCAGAACCCAACCTCCGAGCAGTACATGCTAAGACTTCACCAGTCAAAGCG
 53AACTACTATACTCAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAA
 54CAGCGCAATCCTATTCTAGAGTCCATATCAACAATAGGGTTTACGACCTCGATGTTGGAT
 55CAGGACATCCCGATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATTAAAGTCCT
 56ACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTACTTCAAATTCCTC
 57CCTGTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCCCCGTAAATG
 58ATATCATCTCAACTTAGTATTATACCCACACCCACCCAAGAACAGGGTTTgttaagatgg
 59cagagcccggtaatcgcataaaacttaaaactttacagtcagaggttcaattcctcttct
 60taacaacaTACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAATCGCAATGGC
 61ATTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAAAGGCCCCAA
 62CGTTGTAGGCCCCTACGGGCTACTACAACCCTTCGCTGACGCCATAAAACTCTTCACCAA
 63AGAGCCCCTAAAACCCGCCACATCTACCATCACCCTCTACATCACCGCCCCGACCTTAGC
 64TCTCACCATCGCTCTTCTACTATGAACCCCCCTCCCCATACCCAACCCCCTGGTCAACCT
 65CAACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAGCCGTTTACTCAATCCTCTG
 66>chr4
 67ATCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGCGCACTGCGAGCAGTAGCCCA
 68AACAATCTCATATGAAGTCACCCTAGCCATCATTCTACTATCAACATTACTAATAAGTGG
 69CTCCTTTAACCTCTCCACCCTTATCACAACACAAGAACACCTCTGATTACTCCTGCCATC
 70ATGACCCTTGGCCATAATATGATTTATCTCCACACTAGCAGAGACCAACCGAACCCCCTT
 71CGACCTTGCCGAAGGGGAGTCCGAACTAGTCTCAGGCTTCAACATCGAATACGCCGCAGG
 72CCCCTTCGCCCTATTCTTCATAGCCGAATACACAAACATTATTATAATAAACACCCTCAC
 73CACTACAATCTTCCTAGGAACAACATATGACGCACTCTCCCCTGAACTCTACACAACATA
 74TTTTGTCACCAAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAACAGCATACCC
 75CCGATTCCGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCTACCACTCACCCT
 76AGCATTACTTATATGATATGTCTCCATACCCATTACAATCTCCAGCATTCCCCCTCAAAC
 77CTAAGAAATATGTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGGAGCTTAAACC
 78CCCTTATTTctaggactatgagaatcgaacccatccctgagaatccaaaattctccgtgc
 79cacctatcacaccccatcctaAAGTAAGGTCAGCTAAATAAGCTATCGGGCCCATACCCC
 80GAAAATGTTGGTTATACCCTTCCCGTACTAATTAATCCCCTGGCCCAACCCGTCATCTAC
 81TCTACCATCTTTGCAGGCACACTCATCACAGCGCTAAGCTCGCACTGATTTTTTACCTGA
 82GTAGGCCTAGAAATAAACATGCTAGCTTTTATTCCAGTTCTAACCAAAAAAATAAACCCT
 83CGTTCCACAGAAGCTGCCATCAAGTATTTCCTCACGCAAGCAACCGCATCCATAATCCTT
 84CTAATAGCTATCCTCTTCAACAATATACTCTCCGGACAATGAACCATAACCAATACTACC
 85AATCAATACTCATCATTAATAATCATAATGGCTATAGCAATAAAACTAGGAATAGCCCCC
 86TTTCACTTCTGAGTCCCAGAGGTTACCCAAGGCACCCCTCTGACATCCGGCCTGCTTCTT
 87CTCACATGACAAAAACTAGCCCCCATCTCAATCATATACCAAATCTCTCCCTCACTAAAC
 88GTAAGCCTTCTCCTCACTCTCTCAATCTTATCCATCATAGCAGGCAGTTGAGGTGGATTA
 89AACCAAACCCAGCTACGCAAAATCTTAGCATACTCCTCAATTACCCACATAGGATGAATA
 90ATAGCAGTTCTACCGTACAACCCTAACATAACCATTCTTAATTTAACTATTTATATTATC
 91CTAACTACTACCGCATTCCTACTACTCAACTTAAACTCCAGCACCACGACCCTACTACTA
 92TCTCGCACCTGAAACAAGCTAACATGACTAACACCCTTAATTCCATCCACCCTCCTCTCC
 93CTAGGAGGCCTGCCCCCGCTAACCGGCTTTTTGCCCAAATGGGCCATTATCGAAGAATTC
 94ACAAAAAACAATAGCCTCATCATCCCCACCATCATAGCCACCATCACCCTCCTTAACCTC
 95TACTTCTACCTACGCCTAATCTACTCCACCTCAATCACACTACTCCCCATATCTAACAAC
 96>chr5
 97GTAAAAATAAAATGACAGTTTGAACATACAAAACCCACCCCATTCCTCCCCACACTCATC
 98GCCCTTACCACGCTACTCCTACCTATCTCCCCTTTTATACTAATAATCTTATAGAAATTT
 99AGGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTG
100CAACAGCTAAGGACTGCAAAACCCCACTCTGCATCAACTGAACGCAAATCAGCCACTTTA
101ATTAAGCTAAGCCCTTACTAGACCAATGGGACTTAAACCCACAAACACTTAGTTAACAGC
102TAAGCACCCTAATCAACTGGCTTCAATCTACTTCTCCCGCCGCCGGGAAAAAAGGCGGGA
103GAAGCCCCGGCAGGTTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGAAAATCACCT
104CGGAGCTGGTAAAAAGAGGCCTAACCCCTGTCTTTAGATTTACAGTCCAATGCTTCACTC
105AGCCATTTTACCTCACCCCCACTGATGTTCGCCGACCGTTGACTATTCTCTACAAACCAC
106AAAGACATTGGAACACTATACCTATTATTCGGCGCATGAGCTGGAGTCCTAGGCACAGCT
107CTAAGCCTCCTTATTCGAGCCGAGCTGGGCCAGCCAGGCAACCTTCTAGGTAACGACCAC
108ATCTACAACGTTATCGTCACAGCCCATGCATTTGTAATAATCTTCTTCATAGTAATACCC
109ATCATAATCGGAGGCTTTGGCAACTGACTAGTTCCCCTAATAATCGGTGCCCCCGATATG
110GCGTTTCCCCGCATAAACAACATAAGCTTCTGACTCTTACCTCCCTCTCTCCTACTCCTG
111CTCGCATCTGCTATAGTGGAGGCCGGAGCAGGAACAGGTTGAACAGTCTACCCTCCCTTA
112GCAGGGAACTACTCCCACCCTGGAGCCTCCGTAGACCTAACCATCTTCTCCTTACACCTA
113GCAGGTGTCTCCTCTATCTTAGGGGCCATCAATTTCATCACAACAATTATCAATATAAAA
114CCCCCTGCCATAACCCAATACCAAACGCCCCTCTTCGTCTGATCCGTCCTAATCACAGCA
115GTCCTACTTCTCCTATCTCTCCCAGTCCTAGCTGCTGGCATCACTATACTACTAACAGAC
116CGCAACCTCAACACCACCTTCTTCGACCCCGCCGGAGGAGGAGACCCCATTCTATACCAA
117CACCTATTCTGATTTTTCGGTCACCCTGAAGTTTATATTCTTATCCTACCAGGCTTCGGA
118ATAATCTCCCATATTGTAACTTACTACTCCGGAAAAAAAGAACCATTTGGATACATAGGT
119ATGGTCTGAGCTATGATATCAATTGGCTTCCTAGGGTTTATCGTGTGAGCACACCATATA
120>chr6
121TTTACAGTAGGAATAGACGTAGACACACGAGCATATTTCACCTCCGCTACCATAATCATC
122GCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGCCACACTCCACGGAAGCAATATG
123AAATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCGTAGGTGGC
124CTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTACACGACACGTACTAC
125GTTGTAGCTCACTTCCACTATGTCCTATCAATAGGAGCTGTATTTGCCATCATAGGAGGC
126TTCATTCACTGATTTCCCCTATTCTCAGGCTACACCCTAGACCAAACCTACGCCAAAATC
127CATTTCACTATCATATTCATCGGCGTAAATCTAACTTTCTTCCCACAACACTTTCTCGGC
128CTATCCGGAATGCCCCGACGTTACTCGGACTACCCCGATGCATACACCACATGAAACATC
129CTATCATCTGTAGGCTCATTCATTTCTCTAACAGCAGTAATATTAATAATTTTCATGATT
130TGAGAAGCCTTCGCTTCGAAGCGAAAAGTCCTAATAGTAGAAGAACCCTCCATAAACCTG
131GAGTGACTATATGGATGCCCCCCACCCTACCACACATTCGAAGAACCCGTATACATAAAA
132TCTAGACAaaaaaggaaggaatcgaaccccccaaagctggtttcaagccaaccccatggc
133ctccatgactttttcAAAAAGGTATTAGAAAAACCATTTCATAACTTTGTCAAAGTTAAA
134TTATAGGCTAAATCCTATATATCTTAATGGCACATGCAGCGCAAGTAGGTCTACAAGACG
135CTACTTCCCCTATCATAGAAGAGCTTATCACCTTTCATGATCACGCCCTCATAATCATTT
136TCCTTATCTGCTTCCTAGTCCTGTATGCCCTTTTCCTAACACTCACAACAAAACTAACTA
137ATACTAACATCTCAGACGCTCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATCA
138TCCTAGTCCTCATCGCCCTCCCATCCCTACGCATCCTTTACATAACAGACGAGGTCAACG
139ATCCCTCCCTTACCATCAAATCAATTGGCCACCAATGGTACTGAACCTACGAGTACACCG
140ACTACGGCGGACTAATCTTCAACTCCTACATACTTCCCCCATTATTCCTAGAACCAGGCG
141>chr7
142ACCTGCGACTCCTTGACGTTGACAATCGAGTAGTACTCCCGATTGAAGCCCCCATTCGTA
143TAATAATTACATCACAAGACGTCTTGCACTCATGAGCTGTCCCCACATTAGGCTTAAAAA
144CAGATGCAATTCCCGGACGTCTAAACCAAACCACTTTCACCGCTACACGACCGGGGGTAT
145ACTACGGTCAATGCTCTGAAATCTGTGGAGCAAACCACAGTTTCATGCCCATCGTCCTAG
146AATTAATTCCCCTAAAAATCTTTGAAATAGGGCCCGTATTTACCCTATAGCACCCCCTCT
147ACCCCCTCTAGAGCCCACTGTAAAGCTAACTTAGCATTAACCTTTTAAGTTAAAGATTAA
148GAGAACCAACACCTCTTTACAGTGAAATGCCCCAACTAAATACTACCGTATGGCCCACCA
149TAATTACCCCCATACTCCTTACACTATTCCTCATCACCCAACTAAAAATATTAAACACAA
150ACTACCACCTACCTCCCTCACCAAAGCCCATAAAAATAAAAAATTATAACAAACCCTGAG
151AACCAAAATGAACGAAAATCTGTTCGCTTCATTCATTGCCCCCACAATCCTAGGCCTACC
152CGCCGCAGTACTGATCATTCTATTTCCCCCTCTATTGATCCCCACCTCCAAATATCTCAT
153>chr8
154CAACAACCGACTAATCACCACCCAACAATGACTAATCAAACTAACCTCAAAACAAATGAT
155AGCCATACACAACACTAAAGGACGAACCTGATCTCTTATACTAGTATCCTTAATCATTTT
156TATTGCCACAACTAACCTCCTCGGACTCCTGCCTCACTCATTTACACCAACCACCCAACT
157ATCTATAAACCTAGCCATGGCCATCCCCTTATGAGCGGGCGCAGTGATTATAGGCTTTCG
158CTCTAAGATTAAAAATGCCCTAGCCCACTTCTTACCACAAGGCACACCTACACCCCTTAT
159CCCCATACTAGTTATTATCGAAACCATCAGCCTACTCATTCAACCAATAGCCCTGGCCGT
160ACGCCTAACCGCTAACATTACTGCAGGCCACCTACTCATGCACCTAATTGGAAGCGCCAC
161CCTAGCAATATCAACCATTAACCTTCCCTCTACACTTATCATCTTCACAATTCTAATTCT
162ACTGACTATCCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGTTTTCACACTTCTAGT
163AAGCCTCTACCTGCACGACAACACATAATGACCCACCAATCACATGCCTATCATATAGTA
164AAACCCAGCCCATGACCCCTAACAGGGGCCCTCTCAGCCCTCCTAATGACCTCCGGCCTA
165GCCATGTGATTTCACTTCCACTCCATAACGCTCCTCATACTAGGCCTACTAACCAACACA
166CTAACCATATACCAATGGTGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCAC
167ACACCACCTGTCCAAAAAGGCCTTCGATACGGGATAATCCTATTTATTACCTCAGAAGTT
168TTTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCACTCCAGCCTAGCCCCTACCCCCCAA
169CTAGGAGGGCACTGGCCCCCAACAGGCATCACCCCGCTAAATCCCCTAGAAGTCCCACTC
170CTAAACACATCCGTATTACTCGCATCAGGAGTATCAATCACCTGAGCTCACCATAGTCTA
171ATAGAAAACAACCGAAACCAAATAATTCAAGCACTGCTTATTACAATTTTACTGGGTCTC
172TATTTTACCCTCCTACAAGCCTCAGAGTACTTCGAGTCTCCCTTCACCATTTCCGACGGC
173>chr9
174ATCTACGGCTCAACATTTTTTGTAGCCACAGGCTTCCACGGACTTCACGTCATTATTGGC
175TCAACTTTCCTCACTATCTGCTTCATCCGCCAACTAATATTTCACTTTACATCCAAACAT
176CACTTTGGCTTCGAAGCCGCCGCCTGATACTGGCATTTTGTAGATGTGGTTTGACTATTT
177CTGTATGTCTCCATCTATTGATGAGGGTCTTACTCTTTTAGTATAAATAGTACCGTTAAC
178TTCCAATTAACTAGTTTTGACAACATTCAAAAAAGAGTAATAAACTTCGCCTTAATTTTA
179ATAATCAACACCCTCCTAGCCTTACTACTAATAATTATTACATTTTGACTACCACAACTC
180AACGGCTACATAGAAAAATCCACCCCTTACGAGTGCGGCTTCGACCCTATATCCCCCGCC
181CGCGTCCCTTTCTCCATAAAATTCTTCTTAGTAGCTATTACCTTCTTATTATTTGATCTA
182GAAATTGCCCTCCTTTTACCCCTACCATGAGCCCTACAAACAACTAACCTGCCACTAATA
183GTTATGTCATCCCTCTTATTAATCATCATCCTAGCCCTAAGTCTGGCCTATGAGTGACTA
184CAAAAAGGATTAGACTGAGCCGAATTGGTATATAGTTTAAACAAAACGAATGATTTCGAC
185TCATTAAATTATGATAATCATATTTACCAAATGCCCCTCATTTACATAAATATTATACTA
186GCATTTACCATCTCACTTCTAGGAATACTAGTATATCGCTCACACCTCATATCCTCCCTA
187CTATGCCTAGAAGGAATAATACTATCGCTGTTCATTATAGCTACTCTCATAACCCTCAAC
188ACCCACTCCCTCTTAGCCAATATTGTGCCTATTGCCATACTAGTCTTTGCCGCCTGCGAA
189GCAGCGGTGGGCCTAGCCCTACTAGTCTCAATCTCCAACACATATGGCCTAGACTACGTA
190CATAACCTAAACCTACTCCAATGCTAAAACTAATCGTCCCAACAATTATATTACTACCAC
191TGACATGACTTTCCAAAAAGCACATAATTTGAATCAACACAACCACCCACAGCCTAATTA
192>chr10
193TTAGCATCATCCCCCTACTATTTTTTAACCAAATCAACAACAACCTATTTAGCTGTTCCC
194CAACCTTTTCCTCCGACCCCCTAACAACCCCCCTCCTAATACTAACTACCTGACTCCTAC
195CCCTCACAATCATGGCAAGCCAACGCCACTTATCCAGCGAACCACTATCACGAAAAAAAC
196TCTACCTCTCTATACTAATCTCCCTACAAATCTCCTTAATTATAACATTCACAGCCACAG
197AACTAATCATATTTTATATCTTCTTCGAAACCACACTTATCCCCACCTTGGCTATCATCA
198CCCGATGAGGCAACCAGCCAGAACGCCTGAACGCAGGCACATACTTCCTATTCTACACCC
199TAGTAGGCTCCCTTCCCCTACTCATCGCACTAATTTACACTCACAACACCCTAGGCTCAC
200TAAACATTCTACTACTCACTCTCACTGCCCAAGAACTATCAAACTCCTGAGCCAACAACT
201TAATATGACTAGCTTACACAATAGCTTTTATAGTAAAGATACCTCTTTACGGACTCCACT
202TATGACTCCCTAAAGCCCATGTCGAAGCCCCCATCGCTGGGTCAATAGTACTTGCCGCAG
203TACTCTTAAAACTAGGCGGCTATGGTATAATACGCCTCACACTCATTCTCAACCCCCTGA
204CAAAACACATAGCCTACCCCTTCCTTGTACTATCCCTATGAGGCATAATTATAACAAGCT
205CCATCTGCCTACGACAAACAGACCTAAAATCGCTCATTGCATACTCTTCAATCAGCCACA
206TAGCCCTCGTAGTAACAGCCATTCTCATCCAAACCCCCTGAAGCTTCACCGGCGCAGTCA
207TTCTCATAATCGCCCACGGACTCACATCCTCATTACTATTCTGCCTAGCAAACTCAAACT
208ACGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGGACTTCAAACTCTACTCCCAC
209TAATAGCTTTTTGATGACTTCTAGCAAGCCTCGCTAACCTCGCCTTACCCCCCACTATTA
210ACCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTCCTGATCAAATATCACTCTCC
211TACTTACAGGACTCAACATACTAGTCACAGCCCTATACTCCCTCTACATATTTACCACAA
212CACAATGGGGCTCACTCACCCACCACATTAACAACATAAAACCCTCATTCACACGAGAAA
213ACACCCTCATGTTCATACACCTATCCCCCATTCTCCTCCTATCCCTCAACCCCGACATCA
214TTACCGGGTTTTCCTCTTGTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTGACA
215ACAGAGGCTTACGACCCCTTATTTACCGAGAAAGCTCACAAGAACTGCTAACTCATGCCC
216CCATGTCTAACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGTCTTA
217GGCCCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAACCATGCACACTACTATAAC
218CACCCTAACCCTGACTTCCCTAATTCCCCCCATCCTTACCACCCTCGTTAACCCTAACAA
219AAAAAACTCATACCCCCATTATGTAAAATCCATTGTCGCATCCACCTTTATTATCAGTCT
220CTTCCCCACAACAATATTCATGTGCCTAGACCAAGAAGTTATTATCTCGAACTGACACTG
221AGCCACAACCCAAACAACCCAGCTCTCCCTAAGCTTCAAACTAGACTACTTCTCCATAAT
222ATTCATCCCTGTAGCATTGTTCGTTACATGGTCCATCATAGAATTCTCACTGTGATATAT
223AAACTCAGACCCAAACATTAATCAGTTCTTCAAATATCTACTCATTTTCCTAATTACCAT
224>chr11
225ACTAATCTTAGTTACCGCTAACAACCTATTCCAACTGTTCATCGGCTGAGAGGGCGTAGG
226AATTATATCCTTCTTGCTCATCAGTTGATGATACGCCCGAGCAGATGCCAACACAGCAGC
227CATTCAAGCAGTCCTATACAACCGTATCGGCGATATCGGTTTCATCCTCGCCTTAGCATG
228ATTTATCCTACACTCCAACTCATGAGACCCACAACAAATAGCCCTTCTAAACGCTAATCC
229AAGCCTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAGGCAAATCAGCCCAATTAGG
230TCTCCACCCCTGACTCCCCTCAGCCATAGAAGGCCCCACCCCAGTCTCAGCCCTACTCCA
231CTCAAGCACTATAGTTGTAGCAGGAATCTTCTTACTCATCCGCTTCCACCCCCTAGCAGA
232AAATAGCCCACTAATCCAAACTCTAACACTATGCTTAGGCGCTATCACCACTCTGTTCGC
233AGCAGTCTGCGCCCTTACACAAAATGACATCAAAAAAATCGTAGCCTTCTCCACTTCAAG
234TCAACTAGGACTCATAATAGTTACAATCGGCATCAACCAACCACACCTAGCATTCCTGCA
235CATCTGTACCCACGCCTTCTTCAAAGCCATACTATTTATGTGCTCCGGGTCCATCATCCA
236CAACCTTAACAATGAACAAGATATTCGAAAAATAGGAGGACTACTCAAAACCATACCTCT
237CACTTCAACCTCCCTCACCATTGGCAGCCTAGCATTAGCAGGAATACCTTTCCTCACAGG
238TTTCTACTCCAAAGACCACATCATCGAAACCGCAAACATATCATACACAAACGCCTGAGC
239CCTATCTATTACTCTCATCGCTACCTCCCTGACAAGCGCCTATAGCACTCGAATAATTCT
240TCTCACCCTAACAGGTCAACCTCGCTTCCCCACCCTTACTAACATTAACGAAAATAACCC
241CACCCTACTAAACCCCATTAAACGCCTGGCAGCCGGAAGCCTATTCGCAGGATTTCTCAT
242TACTAACAACATTTCCCCCGCATCCCCCTTCCAAACAACAATCCCCCTCTACCTAAAACT
243>chr12
244CACAGCCCTCGCTGTCACTTTCCTAGGACTTCTAACAGCCCTAGACCTCAACTACCTAAC
245CAACAAACTTAAAATAAAATCCCCACTATGCACATTTTATTTCTCCAACATACTCGGATT
246CTACCCTAGCATCACACACCGCACAATCCCCTATCTAGGCCTTCTTACGAGCCAAAACCT
247GCCCCTACTCCTCCTAGACCTAACCTGACTAGAAAAGCTATTACCTAAAACAATTTCACA
248GCACCAAATCTCCACCTCCATCATCACCTCAACCCAAAAAGGCATAATTAAACTTTACTT
249CCTCTCTTTCTTCTTCCCACTCATCCTAACCCTACTCCTAATCACATAACCTATTCCCCC
250GAGCAATCTCAATTACAATATATACACCAACAAACAATGTTCAACCAGTAACCACTACTA
251ATCAACGCCCATAATCATACAAAGCCCCCGCACCAATAGGATCCTCCCGAATCAACCCTG
252ACCCCTCTCCTTCATAAATTATTCAGCTTCCTACACTATTAAAGTTTACCACAACCACCA
253CCCCATCATACTCTTTCACCCACAGCACCAATCCTACCTCCATCGCTAACCCCACTAAAA
254CACTCACCAAGACCTCAACCCCTGACCCCCATGCCTCAGGATACTCCTCAATAGCCATCG
255CTGTAGTATATCCAAAGACAACCATCATTCCCCCTAAATAAATTAAAAAAACTATTAAAC
256CCATATAACCTCCCCCAAAATTCAGAATAATAACACACCCGACCACACCGCTAACAATCA
257GTACTAAACCCCCATAAATAGGAGAAGGCTTAGAAGAAAACCCCACAAACCCCATTACTA
258AACCCACACTCAACAGAAACAAAGCATACATCATTATTCTCGCACGGACTACAACCACGA
259CCAATGATATGAAAAACCATCGTTGTATTTCAACTACAAGAACACCAATGACCCCAATAC
260GCAAAATTAACCCCCTAATAAAATTAATTAACCACTCATTCATCGACCTCCCCACCCCAT
261CCAACATCTCCGCATGATGAAACTTCGGCTCACTCCTTGGCGCCTGCCTGATCCTCCAAA
262TCACCACAGGACTATTCCTAGCCATACACTACTCACCAGACGCCTCAACCGCCTTTTCAT
263CAATCGCCCACATCACTCGAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCA
264ATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCCTATATTACG
265GATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTATCCTCCTGCTTGCAACTATAG
266CAACAGCCTTCATAGGCTATGTCCTCCCGTGAGGCCAAATATCATTCTGAGGGGCCACAG
267TAATTACAAACTTACTATCCGCCATCCCATACATTGGGACAGACCTAGTTCAATGAATCT
268GAGGAGGCTACTCAGTAGACAGTCCCACCCTCACACGATTCTTTACCTTTCACTTCATCT
269TACCCTTCATTATTGCAGCCCTAGCAGCACTCCACCTCCTATTCTTGCACGAAACGGGAT
270CAAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAATCACCTTCCACCCTTACTACA
271CAATCAAAGACGCCCTCGGCTTACTTCTCTTCCTTCTCTCCTTAATGACATTAACACTAT
272TCTCACCAGACCTCCTAGGCGACCCAGACAATTATACCCTAGCCAACCCCTTAAACACCC
273CTCCCCACATCAAGCCCGAATGATATTTCCTATTCGCCTACACAATTCTCCGATCCGTCC
274CTAACAAACTAGGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAGCAATAATCC
275CCATCCTCCATATATCCAAACAACAAAGCATAATATTTCGCCCACTAAGCCAATCACTTT
276ATTGACTCCTAGCCGCAGACCTCCTCATTCTAACCTGAATCGGAGGACAACCAGTAAGCT
277>chr13
278ACCCTTTTACCATCATTGGACAAGTAGCATCCGTACTATACTTCACAACAATCCTAATCC
279TAATACCAACTATCTCCCTAATTGAAAACAAAATACTCAAATGGGCCTGTCCTTGTAGTA
280TAAACTAATACACCAGTCTTGTAAACCGGAGACGAAAACCTTTTTCCAAGGACAAATCAG
281AGAAAAAGTCTTTAACTCCACCATTAGCACCCAAAGCTAAGATTCTAATTTAAACTATTC
282TCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAAC
283AACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAA
284TACTTGACCACCTGTAGTACATAAAAACCCAACCCACATCAAACCCCCCCCCCCCATGCT
285TACAAGCAAGTACAGCAATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA
286CCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAA
287GTCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCC
288CCTCAGATAGGGGTCCCTTGACCACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTG
289CTACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGAC
290ATCTGGTTCCTACTTCAGGGCCATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAG
291ACATCACGATG
292>chr20
293NNNNNNNNNNNNNNNNNNNNGATCCAgaggtggaagaggaaggaagcttggaaccctata
294gagttgctgagtgccaggaccagatcctggccctaaacaggtggtaaggaaggagagagt
295gaaggaactgccaggtgacacactcccaccatggacctctgggatcctagctttaagaga
296tcccatcacccacatgaacgtttgaattgacagggggagctgcctggagagtaggcagat
297gcagagctcaagcctgtgcagagcccaggttttgtgagtgggacagttgcagcaaaacac
298aaccataggtgcccatccaccaaggcaggctctccatcttgctcagagtggctctagccc
299ttgctgactgctgggcagggagagagcagagctaacttcctcatgggacctgggtgtgtc
300tgatctgtgcacaccactatccaaccgatcccgaggctccaccctggccactcttgtgtg
301cacacagcacagcctctactgctacacctgagtactttgccagtggcctggaagcacttt
302gtcccccctggcacaaatggtgctggaccacgaggggccagagaacaaagccttgggcgt