PageRenderTime 8ms CodeModel.GetById 1ms app.highlight 2ms RepoModel.GetById 1ms app.codeStats 1ms

/test-data/emboss_backtranseq_out.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 30 lines | 30 code | 0 blank | 0 comment | 0 complexity | a6c341c869697f37ef08aa16e80088fb MD5 | raw file
 1>Sequence 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 2GGCACCACCTGCGGCGCCACCGGCTGCTGCACCGCCGCCGCCGCCACCGCCTGCTGCACC
 3ACCTGCACCACCACCACCGGCACCTGCTGCTGCACCGCCTGCGCCTGCGCCGGCGCCTGC
 4TGCGCCTGCGCCGGCACCACCACCACCTGCTGCACCGCCGCCACCGGCGGCTGCACCACC
 5ACCGCCTGCGCCTGCTGCGGCGCCTGCACCGCCGGCGCCGCCGCCACCACCTGCACCACC
 6GGCACCGGCTGCGCCGCCGGCTGCGCCTGCACCGCCGCCACCACCGGCGCCGCCGCCGGC
 7TGCGGCGGCACCACCGGCGGCTGCTGCACCGCCGGCGCCGGCACCGGCACCACCGCCTGC
 8TGCGGCGGCACCACCACCGGCACCGCCACCGCCGGCTGCACCGGCGCCGGCTGCGGCTGC
 9GGCACCTGCACCTGCACCACCGGCTGCTGCTGCACCGGCGCCACCTGCGCCGCCGCCGGC
10GGCACCACCTGCGCCACCACCACCACCTGCACCTGCACCGCCTGCACCACCACCGGCGGC
11GCCGCCGGCGCCTGCGGCACCACCGGCACCGGCGGCGCCGCCGGCGCCGCCACCGCCTGC
12GCCGCCTGCGCCGCCGGCACCGCCTGCGGCGCCGGCACCTGCACCTGCACCTGCTGCTGC
13TGCTGCTGCACCGGCGGCACCACCACCGGCTGCACCGGCGCCACCACCGCCTGCACCGGC
14GGCGCCACCGCCTGCGCCGGCACCACCGGCACCGCCGCCACCGCCTGCTGCTGCACCACC
15TGCGGCTGCGCCGCCTGCGCCTGCTGCGGCTGCGGCACCGCCGCCTGCACCGCCACCTGC
16ACCGCCACCGCCACCGGCGCCGCCACCACCGCCACCACCACCACCTGCTGCTGCACCACC
17ACCGCCACCACCGCCACCGCCACCGGCACCGCCGGCACCGCCGGCGGCACCACCTGCGGC
18ACCTGCACCACCACCGCCGCCACCTGCACCACCTGCTGCACCACCACCGCCGGCTGCGCC
19GCCGGCACCTGCACCACCACCACCGCCTGCACCGGCACCACCACCACCTGCGGCGCCTGC
20TGCACCTGCGCCGCCACCGGCACCACCTGCGCCACCGGCACCACCTGCACCACCGCCGGC
21GGCACCACCGGCACCACCACCACCGGCGGCGCCACCGCCGCCACCGCCACCGGCTGCGGC
22GGCACCTGCGCCGGCACCACCACCGCCGCCACCTGCACCACCTGCGGCACCACCGGCACC
23ACCACCTGCACCACCTGCACCACCGCCGCCGCCGCCACCGCCACCACCACCGCCACCACC
24TGCGCCACCGGCGGCACCACCACCGCCGCCACCACCACCACCACCGGCGGCACCACCACC
25GGCACCGCCTGCACCACCGGCACCACCTGCGCCGGCGGCGGCGGCTGCTGCGCCGGCACC
26ACCTGCGCCACCACCGCCACCACCACCGCCTGCACCTGCACCGGCACCACCACCGGCACC
27GCCACCGCCTGCGCCGGCTGCGCCGGCACCACCTGCACCACCACCACCGCCACCACCACC
28ACCACCGCCGGCACCGCCACCGGCGCCACCACCACCACCGCCGCCACCACCACCGCCGCC
29GCCGCCTGCGCCGCCACCACCTGCACCGCCGCCACCGGCGGCACCTGCGCCGCCGCCGCC
30GCC