PageRenderTime 40ms CodeModel.GetById 28ms app.highlight 4ms RepoModel.GetById 2ms app.codeStats 0ms

/test-data/fastqc_data.txt

https://bitbucket.org/cistrome/cistrome-harvard/
Plain Text | 558 lines | 558 code | 0 blank | 0 comment | 0 complexity | f1e0418e1bdffc4da92c6f06f4424d60 MD5 | raw file
  1##FastQC	0.9.1
  2>>Basic Statistics	pass
  3#Measure	Value	
  4Filename	1000gsample.fastq	
  5File type	Conventional base calls	
  6Encoding	Sanger / Illumina 1.9	
  7Total Sequences	5000	
  8Sequence length	54	
  9%GC	43	
 10>>END_MODULE
 11>>Per base sequence quality	warn
 12#Base	Mean	Median	Lower Quartile	Upper Quartile	10th Percentile	90th Percentile
 131	28.9946	31.0	27.0	33.0	22.0	34.0
 142	28.486	30.0	26.0	32.0	21.0	33.0
 153	28.5272	30.0	26.0	32.0	21.0	34.0
 164	28.6252	30.0	26.0	32.0	22.0	33.0
 175	28.4804	30.0	26.0	32.0	21.0	33.0
 186	28.5128	30.0	26.0	32.0	22.0	33.0
 197	28.4102	30.0	26.0	32.0	21.0	33.0
 208	28.4674	30.0	26.0	32.0	22.0	33.0
 219	28.182	30.0	26.0	32.0	21.0	33.0
 2210	28.0908	30.0	26.0	32.0	21.0	33.0
 2311	28.1876	30.0	26.0	32.0	21.0	33.0
 2412	28.1742	30.0	26.0	32.0	21.0	33.0
 2513	27.923	30.0	25.0	32.0	20.0	33.0
 2614	27.8984	29.0	25.0	32.0	21.0	33.0
 2715	27.6112	29.0	25.0	32.0	20.0	33.0
 2816	27.6638	29.0	25.0	32.0	20.0	33.0
 2917	27.5734	29.0	25.0	32.0	20.0	33.0
 3018	27.6348	29.0	25.0	32.0	20.0	33.0
 3119	27.6526	29.0	25.0	32.0	20.0	33.0
 3220	27.2716	29.0	24.0	32.0	19.0	33.0
 3321	27.2642	29.0	25.0	31.0	19.0	33.0
 3422	26.881	28.0	24.0	31.0	19.0	33.0
 3523	26.8124	28.0	24.0	31.0	19.0	33.0
 3624	26.8204	28.0	24.0	31.0	19.0	33.0
 3725	26.6606	28.0	24.0	31.0	18.0	33.0
 3826	26.3806	28.0	23.0	31.0	18.0	33.0
 3927	25.947	28.0	23.0	31.0	17.0	33.0
 4028	25.7446	27.0	22.0	31.0	16.0	33.0
 4129	25.6856	27.0	22.0	31.0	16.0	33.0
 4230	25.5228	27.0	22.0	31.0	16.0	33.0
 4331	25.354	27.0	22.0	30.0	16.0	32.0
 4432	25.1656	27.0	22.0	30.0	16.0	32.0
 4533	25.0164	26.0	21.0	30.0	15.0	32.0
 4634	24.75	26.0	21.0	30.0	15.0	32.0
 4735	24.3926	26.0	21.0	30.0	15.0	32.0
 4836	24.1122	25.0	20.0	30.0	14.0	32.0
 4937	23.8612	25.0	20.0	29.0	13.0	32.0
 5038	23.7544	25.0	20.0	29.0	13.0	32.0
 5139	23.485	25.0	19.0	29.0	13.0	32.0
 5240	23.1984	24.0	19.0	29.0	13.0	32.0
 5341	23.0976	24.0	19.0	29.0	13.0	32.0
 5442	22.9212	24.0	19.0	28.0	13.0	31.0
 5543	22.5172	24.0	18.0	28.0	12.0	31.0
 5644	22.3234	23.0	18.0	28.0	12.0	31.0
 5745	22.1372	23.0	18.0	28.0	11.0	31.0
 5846	22.2166	23.0	18.0	28.0	11.0	31.0
 5947	22.075	23.0	18.0	28.0	11.0	31.0
 6048	21.4592	22.0	17.0	27.0	11.0	31.0
 6149	21.0954	22.0	16.0	27.0	10.0	30.0
 6250	20.9356	22.0	16.0	27.0	10.0	30.0
 6351	20.6152	21.0	15.0	27.0	9.0	30.0
 6452	20.6588	21.0	16.0	27.0	9.0	30.0
 6553	19.5852	20.0	14.0	25.0	9.0	29.0
 6654	19.9424	21.0	14.0	26.0	7.0	30.0
 67>>END_MODULE
 68>>Per sequence quality scores	warn
 69#Quality	Count
 708	4.0
 719	4.0
 7210	2.0
 7311	2.0
 7412	4.0
 7513	6.0
 7614	4.0
 7715	11.0
 7816	20.0
 7917	50.0
 8018	98.0
 8119	149.0
 8220	210.0
 8321	275.0
 8422	367.0
 8523	425.0
 8624	518.0
 8725	540.0
 8826	539.0
 8927	532.0
 9028	468.0
 9129	360.0
 9230	234.0
 9331	122.0
 9432	51.0
 9533	5.0
 96>>END_MODULE
 97>>Per base sequence content	pass
 98#Base	G	A	T	C
 991	1075	1632	1296	997
1002	1202	1586	1327	885
1013	1079	1443	1471	1007
1024	1079	1414	1445	1062
1035	1058	1486	1416	1040
1046	1119	1462	1286	1133
1057	1067	1516	1412	1005
1068	1079	1453	1397	1071
1079	1015	1424	1429	1132
10810	1060	1542	1328	1070
10911	1057	1432	1364	1147
11012	1066	1444	1450	1040
11113	1018	1461	1447	1074
11214	1001	1460	1461	1078
11315	1010	1461	1419	1110
11416	1017	1469	1465	1049
11517	1030	1457	1425	1088
11618	1030	1396	1470	1104
11719	1083	1423	1429	1065
11820	1000	1462	1448	1090
11921	1086	1425	1409	1080
12022	1026	1544	1365	1065
12123	1036	1445	1486	1033
12224	1056	1431	1379	1134
12325	1055	1453	1458	1034
12426	1109	1419	1406	1064
12527	1067	1426	1438	1068
12628	967	1527	1373	1133
12729	1045	1456	1452	1046
12830	1055	1470	1372	1103
12931	1042	1402	1433	1123
13032	992	1418	1437	1151
13133	1104	1431	1363	1101
13234	1065	1464	1363	1107
13335	1054	1471	1411	1063
13436	1070	1433	1440	1056
13537	1044	1471	1426	1057
13638	1093	1451	1403	1052
13739	1096	1412	1352	1138
13840	1066	1425	1391	1118
13941	1083	1405	1380	1129
14042	1114	1401	1385	1097
14143	1062	1421	1391	1125
14244	1070	1449	1377	1103
14345	1093	1464	1337	1106
14446	1063	1377	1387	1173
14547	1081	1413	1402	1102
14648	1064	1422	1320	1194
14749	1052	1452	1359	1136
14850	1091	1407	1340	1160
14951	1051	1386	1400	1161
15052	1091	1507	1297	1104
15153	1058	1416	1402	1123
15254	1072	1345	1339	1221
153>>END_MODULE
154>>Per base GC content	pass
155#Base	%GC
1561	41.44
1572	41.74
1583	41.72
1594	42.82
1605	41.959999999999994
1616	45.04
1627	41.44
1638	43.0
1649	42.94
16510	42.6
16611	44.080000000000005
16712	42.120000000000005
16813	41.839999999999996
16914	41.58
17015	42.4
17116	41.32
17217	42.36
17318	42.68
17419	42.96
17520	41.8
17621	43.32
17722	41.82
17823	41.38
17924	43.8
18025	41.78
18126	43.47739095638256
18227	42.70854170834167
18328	42.0
18429	41.82836567313463
18530	43.16
18631	43.3
18732	42.87715086034414
18833	44.10882176435287
18934	43.44868973794759
19035	42.34846969393879
19136	42.528505701140226
19237	42.03681472589035
19338	42.90858171634327
19439	44.697879151660665
19540	43.68
19641	44.266559935961574
19742	44.24654792875725
19843	43.74874974994999
19944	43.468693738747746
20045	43.980000000000004
20146	44.72
20247	43.677470988395356
20348	45.16
20449	43.76875375075015
20550	45.038015206082434
20651	44.25770308123249
20752	43.908781756351274
20853	43.628725745149026
20954	46.071930882057465
210>>END_MODULE
211>>Per sequence GC content	warn
212#GC Content	Count
2130	3.0
2141	5.0
2152	7.0
2163	7.0
2174	7.0
2185	5.0
2196	2.0
2207	1.0
2218	1.5
2229	2.0
22310	1.5
22411	1.0
22512	2.5
22613	4.0
22714	4.0
22815	4.0
22916	5.0
23017	6.0
23118	11.0
23219	19.5
23320	23.0
23421	37.5
23522	52.0
23623	61.0
23724	70.0
23825	79.0
23926	88.0
24027	117.5
24128	147.0
24229	159.5
24330	172.0
24431	203.0
24532	243.0
24633	252.0
24734	290.0
24835	328.0
24936	330.0
25037	332.0
25138	332.5
25239	333.0
25340	342.0
25441	351.0
25542	343.5
25643	336.0
25744	318.5
25845	279.5
25946	258.0
26047	254.5
26148	251.0
26249	234.5
26350	218.0
26451	209.5
26552	201.0
26653	198.5
26754	196.0
26855	177.0
26956	162.5
27057	167.0
27158	147.0
27259	127.0
27360	106.5
27461	86.0
27562	85.0
27663	84.0
27764	61.5
27865	39.0
27966	42.5
28067	46.0
28168	34.0
28269	17.0
28370	12.0
28471	14.0
28572	16.0
28673	12.5
28774	9.0
28875	6.5
28976	4.0
29077	4.5
29178	5.0
29279	5.0
29380	5.0
29481	3.0
29582	1.0
29683	1.0
29784	1.0
29885	1.0
29986	1.0
30087	1.0
30188	1.0
30289	1.0
30390	2.0
30491	3.0
30592	2.5
30693	2.0
30794	2.0
30895	3.0
30996	4.0
31097	5.0
31198	6.0
31299	3.5
313100	1.0
314>>END_MODULE
315>>Per base N content	pass
316#Base	N-Count
3171	0.0
3182	0.0
3193	0.0
3204	0.0
3215	0.0
3226	0.0
3237	0.0
3248	0.0
3259	0.0
32610	0.0
32711	0.0
32812	0.0
32913	0.0
33014	0.0
33115	0.0
33216	0.0
33317	0.0
33418	0.0
33519	0.0
33620	0.0
33721	0.0
33822	0.0
33923	0.0
34024	0.0
34125	0.0
34226	0.04
34327	0.02
34428	0.0
34529	0.02
34630	0.0
34731	0.0
34832	0.04
34933	0.02
35034	0.02
35135	0.02
35236	0.02
35337	0.04
35438	0.02
35539	0.04
35640	0.0
35741	0.06
35842	0.06
35943	0.02
36044	0.02
36145	0.0
36246	0.0
36347	0.04
36448	0.0
36549	0.02
36650	0.04
36751	0.04
36852	0.02
36953	0.02
37054	0.45999999999999996
371>>END_MODULE
372>>Sequence Length Distribution	pass
373#Length	Count
37454	5000.0
375>>END_MODULE
376>>Sequence Duplication Levels	pass
377#Total Duplicate Percentage	0.66
378#Duplication Level	Relative count
3791	100.0
3802	0.08053150795248641
3813	0.040265753976243206
3824	0.0
3835	0.020132876988121603
3846	0.0
3857	0.040265753976243206
3868	0.0
3879	0.0
38810++	0.0
389>>END_MODULE
390>>Overrepresented sequences	warn
391#Sequence	Count	Percentage	Possible Source
392CGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAAT	7	0.13999999999999999	Illumina Paired End PCR Primer 2 (96% over 33bp)
393CGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGAC	7	0.13999999999999999	Illumina Paired End PCR Primer 2 (100% over 35bp)
394>>END_MODULE
395>>Kmer Content	fail
396#Sequence	Count	Obs/Exp Overall	Obs/Exp Max	Max Obs/Exp Position
397CCCCC	1110	9.557241	23.193876	44
398AAAAA	2130	4.1300144	5.698024	7
399CTCCC	530	3.5749238	11.56272	11
400CCTCC	510	3.440021	11.56272	14
401CTGGG	465	3.1575248	8.314476	45
402TGGAA	785	2.929684	6.397646	17
403GGGGG	335	2.9167063	10.660779	6
404GAATG	775	2.8923633	10.053445	20
405CCCAG	450	2.8820548	7.8420706	22
406GTGTG	520	2.7661672	6.513526	23
407TGTGT	660	2.744307	6.109576	27
408GGGAG	425	2.7401958	6.315732	6
409ATGGA	730	2.7244196	6.397646	20
410GCTGG	395	2.6821985	6.651581	16
411GGAGG	410	2.643483	7.894665	7
412GGAAT	700	2.612457	7.3115954	19
413GCAGG	400	2.5732677	14.17877	16
414CCTGG	370	2.5068476	6.6367774	7
415CAGCC	380	2.4337354	6.273657	4
416TGGGA	480	2.419065	7.40506	20
417AATGG	645	2.4071925	5.4836965	18
418GCCTC	355	2.3998654	6.622006	2
419CCCTC	355	2.394524	8.259085	13
420CCAGC	370	2.3696895	6.2736564	14
421GGAAG	495	2.3634295	14.031037	2
422GGCTG	345	2.3426795	9.97737	24
423CAGGA	490	2.3343499	13.99981	17
424CCAGG	360	2.3107867	6.2876506	11
425CTGTG	435	2.3088553	9.09864	44
426GCCTG	340	2.3035896	8.295971	5
427TCCCA	460	2.3028264	6.1297736	9
428CTGCC	340	2.2984629	8.277508	10
429CAGCA	480	2.2816207	10.47649	14
430TTCCT	545	2.256056	7.0961456	1
431CTCCT	415	2.1929073	6.4701333	15
432TCCCC	325	2.1921701	6.6072683	28
433CAGGC	335	2.1503155	6.2876506	14
434CCCCA	335	2.1407545	6.259694	20
435TGGTG	400	2.127821	6.513526	9
436CCCCT	315	2.1247187	6.607268	12
437GGCAG	330	2.122946	6.301676	16
438CTCTG	400	2.1183603	5.187652	16
439TTCCA	540	2.1177678	6.7228537	28
440CAGAG	440	2.0961509	5.833255	28
441CCCTG	310	2.095657	6.622006	24
442AGGGA	435	2.0769534	5.846266	1
443CTCAG	410	2.0570977	6.143447	24
444CTTCC	385	2.034384	6.4701333	17
445AGCAG	425	2.0246909	10.499857	15
446AGGAA	570	2.015381	10.390455	18
447TCCTC	380	2.0079634	5.1761065	1
448TCAGC	400	2.0069244	12.286894	44
449AGAGC	420	2.0008712	10.499858	5
450TCCTG	375	1.9859626	6.4845653	8
451TCTCC	375	1.9815428	5.1761065	8
452CACCC	310	1.9809967	6.259694	9
453TGTGG	370	1.9682345	5.210821	4
454GATGG	390	1.9654902	6.1708827	1
455TGGCT	370	1.9638538	9.098641	45
456TCCCT	370	1.9551222	5.1761065	37
457CAGGG	300	1.9299511	6.3016763	21
458AAGAG	545	1.9269869	9.524584	4
459CAGAA	545	1.9226985	6.0476103	6
460CTGAG	380	1.9108309	6.15715	11
461TCTCT	460	1.9041945	5.068676	8
462GAGGC	295	1.897785	6.301676	22
463CCCAC	295	1.885142	6.259694	4
464CCTGC	275	1.8590509	9.93301	6
465CCTGT	350	1.8535651	6.4845653	6
466TTTCC	445	1.8421009	5.0686755	14
467TGCCT	345	1.8270856	5.187652	12
468CACAC	380	1.8022629	5.8073177	17
469CCTCT	340	1.7965988	7.7641597	2
470TTCCC	340	1.7965986	6.470133	18
471GAAGA	500	1.767878	7.792842	26
472CTGGC	260	1.7615684	6.636777	8
473TTCAG	440	1.7294377	9.6255	12
474CTCTC	325	1.717337	5.1761065	3
475GTGGT	320	1.7022567	5.2108207	24
476GGGTG	250	1.7013805	8.333022	28
477TGCTT	410	1.7010024	5.0799813	4
478CTTTG	405	1.6802584	5.0799813	2
479AGAAG	475	1.6794841	5.1952276	22
480ACTCC	330	1.6520276	6.1297736	10
481CTGCT	310	1.6417291	6.4845653	3
482GCCCC	190	1.6395733	6.339712	37
483AGTGG	325	1.6379085	6.1708827	3
484TGGCA	325	1.6342632	6.1571493	16
485GGCTC	240	1.626063	6.636776	25
486ACACA	460	1.6192161	5.1721287	14
487GCTTT	390	1.6180266	5.0799813	5
488TTCTG	390	1.6180266	5.0799813	3
489TCCTT	390	1.6144258	6.0824113	16
490CCCAA	335	1.588837	5.8073177	10
491GCACA	330	1.5686142	5.8202715	18
492GTTCA	395	1.5525635	7.700401	11
493TCTTC	375	1.5523325	5.068676	4
494AGGCA	325	1.5482932	5.8332543	6
495GGGGA	240	1.5474048	6.3157325	7
496CCTTC	290	1.5323931	6.4701333	17
497ATGCC	305	1.5302798	12.286893	22
498GAAGG	320	1.5278738	5.8462653	8
499GGGAT	295	1.4867171	7.40506	21
500TGTGC	280	1.4861598	5.199224	7
501AACAG	420	1.4817125	5.1836653	10
502TCTTT	455	1.4755235	5.5590916	1
503TTGGC	275	1.4596211	5.199223	15
504GAGAT	385	1.4368514	6.397646	27
505TTTGG	345	1.4345239	6.1095753	3
506GGTTC	270	1.4330826	10.398446	10
507CCTTG	265	1.4034137	5.187652	18
508CCCTT	265	1.4002901	5.176106	14
509CTGTT	335	1.3898433	5.0799813	10
510CCTTT	335	1.3867503	5.068676	8
511GGCAC	215	1.3800533	6.2876506	17
512TTGAA	465	1.3564935	6.4295163	7
513CTTGG	255	1.3534669	5.1992235	18
514GTGTT	325	1.3513632	5.091313	28
515GGCCC	155	1.3405302	6.353853	2
516TGGTT	320	1.330573	5.091313	25
517TTCTT	410	1.3295923	7.941558	4
518GGGGT	195	1.327077	8.333022	45
519AAGGA	375	1.3259085	5.1952276	44
520CAGAT	350	1.3033215	5.471493	10
521CTGGT	245	1.3003898	5.1992235	12
522TGTCC	245	1.2974956	5.187652	21
523GCTCC	190	1.2844352	8.277508	26
524GACAG	265	1.2624544	5.833254	27
525GAGCG	195	1.2544682	12.603353	6
526TTGGG	235	1.2500948	6.5135255	6
527AATGC	335	1.2474647	10.031068	21
528GGCTT	235	1.2473125	5.199223	4
529TTTGC	295	1.223892	5.0799813	9
530GGTGT	230	1.223497	5.21082	27
531GATCG	235	1.181698	6.1571493	45
532AGCTC	225	1.1288949	6.1434464	25
533ACCCT	225	1.1263824	6.129773	10
534CGGAA	235	1.119535	9.333206	1
535CCCAT	220	1.1013516	6.129773	21
536TCTTG	265	1.0994283	5.0799813	21
537ATGCA	295	1.0985136	5.4714913	37
538GCTTG	205	1.0880812	5.199223	2
539AGCGG	165	1.061473	12.603352	7
540AACCA	300	1.0560105	5.1721287	22
541AACCT	280	1.0403365	5.4593143	13
542CCGAG	160	1.0270164	12.575301	25
543TTGCC	190	1.0062209	5.1876516	3
544ACTCA	265	0.9846043	5.4593153	11
545CTCAT	250	0.98044825	5.7624474	4
546GTTCC	185	0.9797416	6.4845653	27
547GAACC	205	0.97444224	5.820272	25
548GGCGG	110	0.9555928	10.637051	44
549GCGGT	130	0.8827489	13.303162	8
550GCGGG	100	0.86872077	6.3822303	45
551TGCCG	125	0.846908	14.93275	23
552AGGCG	120	0.7719804	6.3016763	15
553CGGTT	140	0.74307984	10.398446	9
554GCCGA	115	0.738168	12.575301	24
555CGAGA	130	0.61931723	9.333206	26
556CGGGA	85	0.5468194	6.301676	24
557CACGG	85	0.54560244	6.2876506	37
558>>END_MODULE