PageRenderTime 24ms CodeModel.GetById 19ms app.highlight 1ms RepoModel.GetById 1ms app.codeStats 0ms

/test-data/solexa.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 60 lines | 60 code | 0 blank | 0 comment | 0 complexity | 8282cf20783fdcc1782d0f5ed2f3526d MD5 | raw file
 1>0
 2GACTCATGATTTCTTACCTATTAGTGGTTGAACATC
 3>1
 4GTGATATGTATGTTGACGGCCATAAGGCTGCTTCTT
 5>2
 6GTTGTCGATAGAACTTCATGTGCCTGTAAAACAAGT
 7>3
 8ACCAACCAGAACGTGAAAAAGCGTCCTGCGTGTAGC
 9>4
10GTTTATGTTGGTTTCATGGTTTTGTCTAACTTTATC
11>5
12GCTTTACCGTCTTTCCAGAAATTGTTCCAAGTATCG
13>6
14GCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGC
15>7
16GTTATAACGCCGAAGCGGTAAAAATTTTTATTTTTT
17>8
18GTTCTCACTTCTGTTACTCCAGCTTCTTCGGCACCT
19>9
20GTGGCCTGTTGATTCTAAAGGTTAGTTTCTTCACGC
21>10
22GTGACCGCATAAAGTGCACAACATGGAAATGAGGAC
23>11
24GCAGATCGCTACACGCAGGACGCTTTTTCACGTTCT
25>12
26GCTCGTTATGGTTTCCGTTGCTGCCATCTCAAAAAC
27>13
28GTTGACGGCCATAAGGCTGCTTCTGACGTTCGTGAT
29>14
30GTCAAGGACTGGTTTAGATATGAGTCACATTTTGTT
31>15
32GTGCTGAGTTTTTTTCTGTTACTGTGACATTAATTT
33>16
34GACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGG
35>17
36GGAAAATGAGAAAATTCGACCTATCCTTGCGCAGCT
37>18
38GAGTCTCATTTTGCATCTCGGCAATCTCTTTCTGAT
39>19
40GTCATAAGAGGTTTTACCTCCAAATGAAGAAATAAC
41>20
42GCTGGTAATGGTGGTTTTTTTTTTTTTTTTTTTTTT
43>21
44GTTGAGGCTTGCGTTTATGGTACGCTGGACTTTGTA
45>22
46GAGGAGAGTGCAGGTATTAATATCAAGGTTTGTGAG
47>23
48GGCGACTTCACGCCAGAATACGAAATACCAGGTATT
49>24
50GCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGA
51>25
52GGGATGAACATAATAAGCAATGACGGCAGCAATAAA
53>26
54GTATTTTACCAATGACCAAATCAAAGAAATGACTCG
55>27
56GTTTTTAGTGAGTTGTTCCATTCTTTAGCTCCTAGA
57>28
58GTATTGATAAAGCTGTTGCCGATACTTAGCACTATT
59>29
60GCGTACTTATTCGCCACCATGATTATTACCAGTGTT