PageRenderTime 7ms CodeModel.GetById 2ms app.highlight 1ms RepoModel.GetById 1ms app.codeStats 0ms

/test-data/4.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 7 lines | 7 code | 0 blank | 0 comment | 0 complexity | c7bbf431fa37334c84fedb1a46180704 MD5 | raw file
1>EYKX4VC01B65GS length=54 xy=0784_1754 region=1 run=R_2007_11_07_16_15_57_
2CCGGTATCCGGGTGCCGTGATGAGCGCCACCGGAACGAATTCGACTATGCCGAA
3>EYKX4VC01BNCSP length=187 xy=0558_3831 region=1 run=R_2007_11_07_16_15_57_
4CTTACCGGTCACCACCGTGCCTTCAGGATTGATCGCCAGATCGGTCGGTGCGTCAGGCGG
5GGTGACATCGCCCACCACGGTACTCACTGGCTGGCTCTGGTTCCCGGCGGCATCGGAGGC
6CACCACGTTGAGGGTATTCCCCTCGGTTTGTGGCTCGGTGAGAACCACGTTGTAGTCGCC
7ATTGGTC