PageRenderTime 66ms CodeModel.GetById 16ms app.highlight 14ms RepoModel.GetById 1ms app.codeStats 1ms

/test-data/hg19chrX_midpart.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 751 lines | 751 code | 0 blank | 0 comment | 0 complexity | 8889fc451391595f02b64ef42adefcee MD5 | raw file
  1>chrX_part
  2TCTGTTAGACTCACTCAGGACTGTATGAGCATCACCTGTGCTGCACTGTG
  3ACTTTACAGATATTAACGAAGAATCCTCAAGGATCTGTGTTTCGGAGGCA
  4ATCTGGTGACCAGCAGCATTCTCAGCATTCAAATGATGACCCTCAAAATA
  5GGCAGTAGCATTTTTATCTGCTCTGTCATTGGCTACAAAAGACGGCACCA
  6CTGGTACTGATCTTGGTAGCTGATATTCAGGAGAAAGGCTGACCAAGGGT
  7GTATATATGCTGGTGTACTGGGGCAAACCTGGTAACACATTTATGTATGC
  8TGGCGATGTCCGGGTGTTATCAAATCTCTGGAAAGGAAGATACGTACAGT
  9ATCCTGTGACCAAATGGGATTGAGCCCAATAAGTTGGTTTCACATCCTCA
 10AGAACCGGTTTGGGAGAATTAGAGGAGACTCGCTTGTAATTTGCATCCTC
 11AGAGCCTGGTTTGGGAGAATTAGAAGAGAACCCTTTGGGTTTCCCATCCT
 12CAGAAACTTGTCTAGAAGAATTATCGGATACTGGTTTGGCCTTCACATCT
 13TCACAAGCTGGCTTGGGAGAATTTGCAGACAAAGGTTTGGGTTTCACATC
 14TTCAGAAGCTGGTGCTGAAGATGAACCTGATACTGGTTTAGACTTTACAT
 15CTGGTTTAAATTCCCTAGCAGCTGAATTAAGTGGTAGTTTAACTTGTAAA
 16TACTCTCCTGCTTTTGAAATGTCTTCTACTTTTGTTTTAATGTTTTTCTT
 17CTTTCTTTTTTTCTTGAGCCGTGATGCAACTTTCTTCAATGCAATACAGT
 18TGTCAATCACAACAAAACGGGGACATCCCAAGAGAAAAGATTTTAAACCT
 19CCTGCTTTTTCTAGTATTGGTCGAGTTTCTTCTGGGAAAAACTCATATTC
 20TTCAGAGAACATCTTGTGACTCATGTCCAAGGGACCATGTTCCTCCAACA
 21ACTGAGAGAAGTAATCATATAGAGTTGAACATTTTTGTTTTGGGTTCATG
 22TCCCATAGCTTCTTATTGCGGACAACATATTCATTACTGTGTTGGTCATA
 23GAGAGCTTCAAATTCTTCTACGTCTTGCCGAAGATGGTCAGGCACTGCAA
 24ATGGGCCTGCAGTATCTGAATTTTGATTGCTATGGTCTTCACTTGAAGTG
 25ATGATCTCATTATTTGGAGTTACTGAAGTTGTTCCAGACCCAACTAACAT
 26AGGCTTTGAATCCTTTGGTTTCTTTTTCTTGCCTTTGTTTTTCACCTTGG
 27TAGAACTAAACGGTGCTTCGCCACTGTCTTGTTTCCTTAACACAGTACAG
 28CGGCTGTCCATTATATCAAAGAATTCATCTAAAGCACTATGTAATGCTGG
 29GAACTTGTCTCTGTGTTCTTCTAGCAGCCATATTAAACAGCGGGCTTCCT
 30TCGATGATGTTGGCTCAAAGAAATAATCAAGTTGCTTTCCTTCTATAGAG
 31TCTAGTTTGTGACCATATTTCTCATTCCAGAGGAAAGTCATGATGCTAAA
 32ATCAAGCTGTTTAAGAGATGCTTCATACCGAGAAAAGAAAGGTCCTGTGG
 33CATCTAAGCCAAAGCTATTAAGTTTTCGGATCCAGGCGGCTAATTTGGGC
 34TCCACTTCTTTAAGCTCACTCAAAACATGCAGAAATATTCTTGTCTTTAC
 35TCTGTTCTTTTCTTGAATCAAGTGACGAATAACATAGTCCACTGCTTCAT
 36TTAGAAAATTTCTGCTTGAAAAACAGGTTGTATAGTCCTCTGTGCTCAAA
 37ACTTTCCAAGAAAGTAATTCTTTGAGAAGCGTGGCTGTATTCCATATGCC
 38GGATTTAATCTTGTCAGCATACTGCTTTATACACTGTAGAATTCTGTCAT
 39CAAGGAACTGACAATGCTGAACATTGTCTACAGTTTCTTTCTGCTCTTCG
 40TTTTTGGGTGGATTACTTTCTCTTAAGTCCTCCTCCATTCTTTCTTGTGC
 41TAATTTTTTTGCTTCTTTTTTTTGGATCTTTCTCTTCAATTTTTTGTCTT
 42CTTTCAGTCTTAGTTTCTCTAGGCTAGAACATTTCTGTTTCAGAATAGGT
 43CTTGGAGGAACCTTTTCTTTTATGACCTTGTGTTCAAATTCACATTTAAC
 44TTGACCACCACTGCTGAAGATGATAATCTTAGAAATGACACCTTCACAGT
 45CAGGGGTAAGACATATTCCTTGTAGAAAATCCTTGTCAATTTTATCATTA
 46AAGGTTGTGGTTTTTAACTTCTTCCAGCAATTCATGTGAAATTCTATTTT
 47ACAGTACTGGCAACAGCTGATGCGTATAAAACCCTTAAAGTCTGGATCAG
 48TTATGTATATCTGGATCTTAGAATATCCACAGCACTTCTGATAGCAACAA
 49ATGGCATCTGGCACTGGAGGGAACTTGCATTCTTCAACAAATTTCTCTAA
 50CAGCATCTTTATTTTTTCTGGCTGAGACTCTTCAATAATCACATTACTTG
 51TGGGCCAAGTTAACACTCCAGGAAGACGATAAATCAAGGTTCTTGCTTTC
 52TCAAAGTGATTGAGAGCTTCTAGAAATCTGTTTTTTTTCAAATATACTTT
 53TCCAATTCCACAGTAGGCCAAGCAATCAAGTCCCTCATTGTGGTAGTGTT
 54CAATAATCCTCTTAAACTGGTTTTCAGCTTCAGATAGTTCTTCAGGCTGT
 55CCTATTCCAAGGAGTGAAATGGCAAGTCCATAGACAACCAAGACATAGTT
 56AATCATGGCCAGATTCAATTGCTTTATTTTTTGAGGATCTAAACCATTCA
 57GCAACTCTGTAAAGGCATGTGCGGCACTGCGGCAACGCTGCTCCAATAAG
 58GCTGTATAGCCATCTTGAATTAAGCTTCTCAGCATTGTCATTATATTAGC
 59AAAATCCTGGTGTGCACCTCTGGAAGATTTAGAAAACTGTTTCTCCAAGA
 60TGTTCTTCAAATCTGCTGGTAAAGTCAATTGTGAACTAGAACTGAACTTT
 61TCTGATTCATTGTTTCGAGATTTTTGTTTTCCTTTATGTTTCGGAGGCTG
 62ACTTGATGGTGGTGAAAATTCAGGATGACAGTCACAATCATCTACCATCA
 63ATGCCTCATCCATCACCTTTAGATTCTGATTACCACCGTTAGCCATTTCG
 64TGATTAATTTTTCTGAAATCTCTTTCCTTCTCCACAAAGTTAAGTGAAGT
 65ACTAAATACAGGTGCTGATAAACTCCTAGGTGTGTAGGCCCTGTTTTCAT
 66AAAAGGCTTTAATTGGATTCTTATTTGCTGTTCGACCTTGTAGGTCTTCT
 67ATTTGTTTTTGTAACTTTACATGCTGCTGAATTAGATCCTTGATTCCCTC
 68AGGGTCATTTTTACAGAGTTTTTGAGCTGTTATGTTTGCTTGCAGGGCCC
 69AGTTATATTCCCCCAGCATAGAAAGAGCATCACAATAACGATAATGACCC
 70TTTGGCCAAGTGTTCTTCAGAATAGTGGCTCTCTTTCCATCACCAAGTGC
 71ATTTCTAAACTGTCCAGTACGAAGAAAACAAAGAGCTCGGTTACCATAAA
 72GAAGGTGGTTTTCAGGTCTATATTCAATGGCTCTGGTGTAATAGATAATA
 73GCTATATCAAATCTTTCTTTGGAAAACTCTTCATTTCCTTTCATTTTCAT
 74TAGTTCTCCTTGCTCTATACAATCCATACAACTTTGGGTTTTAAGTTCTT
 75CAAGCAAATTGCAGTCTTCCATTACAATTTTAGTTATGTGGTACTTGTAT
 76TCAGTAAAGAAAATACTTAACATAGGCCAACAATTGTCAATTGATCCTAA
 77TTTAGTTAGAATTGTTACATCGCCTGCATATTTTATCCAATTCAGAGCTT
 78CTTCCATTGCCAAGATTTTATTTTCTATTTTATAACCAATTCTCAATAAG
 79CCTCCAATAAGGAGTGAATCATTAGCAGCTTTCTTTGCCAAATCCACAAT
 80ATCTTCCATCAACTCAAGATGTTGTAATCTCTTCAAATTTATCTCGGAAG
 81CACGTGAATTGTTGGCGTCCACACAGGGATGCAATCGTGATATTACAGAA
 82CTGTTTTGATGTTGAAACAGAAGTGGCCAGAAGATGTTTATTTTAATGGC
 83ATCACAATAATCTTGCAGGACAGAAATTGGTTTACTACACCATATACTGC
 84AGATGTCAAATTCTAAATTCCTCTCACTTTGGACATAATCTTTATATTGC
 85TTACCCACCCCATCACAGTAAAGCTGAGTCACACGAACATAATCATCGGT
 86CATAAATTCAGCAGCAAAGACACAATCGTCCACGTAAGGGCAATCTTCTA
 87ACAAGGCATAATCCGCCATAGTGAAATCTCCCTCAGCAAAATTGTCCGTG
 88ATGCACAAGTCACGCACACACGGAGGGGTGTGGAAGGCCCCGCTCCCCTG
 89GCATCTCGGCTGCAGCGGGACCAGGTAACACATCCGGGAGCCCGGCCGCG
 90CGCCGGGTGTGCACTCACCCGGGCCTGCCGCCCGCGAGCCTGGGACGCAG
 91GCATccgccgccgccgccgccgccaccgccgccgccgccgcggccgccgc
 92cgcagcagccgccgctgccgccgccgccgccgctgctgccgctgccgctt
 93ccgccgccgccgccgccacctccgGCCCTCTACGTCAGCGGACGGTGGGA
 94GGGAGCGAGTGCTTTTAACTGTTTCGGTGTCAATACTGACCACAGTCATT
 95ATTTTCTCCGGCTGTACTTTAAAGTCTTAATGGTTGAAGCCATGTATCCT
 96TTGCCCACAGACCAGAGGAAGGGGAACCAGGTTCTTTCAGGAAAGTGCAT
 97GGGGGATGCCTCTCTCTCATCATGTCCCCTGACTCCCAGGTGTAATCATA
 98ATCTCCTCATGGAAGTGCCAGGCACATAGAGAGTGCTCTTCCTGCTGCCT
 99CCACTCCTGCTAGACAGAGCCCTGTCAAGGTCATCCTAAGGGCTGGGATC
100CACTAACAGCTTTGACCTTAAAGCAGAGTCTGATATTGGGGATGTCATTT
101CTTCACTCTGATGTACTAATTTTTTTTTTTATCTATACGCTGATGAGAGG
102CTGCTCAGACACCTGCAAATTAGCATCACACTCCCCTAGGTTCTCTAGCA
103AGATATTCTGGGAGGAAAACCTCTGAATCTTATTTCTACCTGTTGCTCAA
104GGAAGGGACTGTTTCCAAAGAAAATCACAGTCGTATACAGGGGAGCTTTT
105CTGTGTCCCTTTTTCTCCTTTGTTCCTTTTCCCCTCTCTCTCTTTTAATG
106GCACCCATTTCTTCCCATCACTTAGAATCACTGAGAATCTTTTTTTACCC
107TGGCTTATAAATTGTGTAGAATTCCTGTAAAGTATGGTGCTCCTTTGTCT
108GTTTCCATTGTCTCTGACCTAATTTTTGACTGACTGGCCATTTACCTGAT
109CCACTTtaaaagccaggagaactgtgttctcatttcagaagaaactgtgt
110taccctggccagttttcttcccttttctgggattcatttcatctgtaaaa
111tggggggCGGGGGTTGACCATCCTGGGTTCTATCTGGAGGTCGATGGGAG
112TCAGagagagagctctgacatggtgatgcagggccttgaactccactcac
113agctctgctgctaacctagcatgtgatttagttctagtccctttccactt
114ctgagcctcagttccccatctAAGCAGCCATGACTGACAAGGGAGAAGTC
115TTAGACTCCCACAAATGAGGACCTTGATCCCCTAACATGACTGTGTGTTC
116ATAAGACCCGTATCCTCTGATCTTGAGCAGATAGAGCCTTTTCTTATCCT
117CTGGATTGCTTCTTGGAAATGGCTGTAGCGAAAGCCTCTTCTTTTGTGCT
118TGATACTTTATTTTCCCAGGTAAGCTCCCTCTACCTTTGTCCTGGGGCAT
119GTATTTATGGATATTTTAGTTAGAAAAAGCTATCAATTAGTGTAATTAGC
120TTATTGTCACCTTCAATCTTGACCCTCTCCCTGCACTGTCCCCTACCCAC
121CTCAGGTTCTCTCTTATTTTAACTTAGTGAGCAGAGCTCCTGGCTGCATC
122ACCATAGCAACCAGCAGCTAGGACCTATTAAGCCATGATGAGTCATTAGA
123CATCTAAGCTGATTATAGAGTCCAGAATGTTAACTGCAGAAGAGATGCTG
124AAAGAAGGAAAATGAGGCAGATCTTAACCTACAAACAAGTAGACAACAGA
125GTAGCTGAGTGCTTCAAACTATCCCCGACCTGGATGCCATGGGCGCTATG
126GGCCTGGGTGTCAACACCTTGGCATGTACCCTCAGCCACCAGACCAGAGG
127GAGGGGCACCAGGCCCATTCTCTTCCCAGGGAAGTAATTCTGGACACCTT
128CCTGCCAACATGCTCCAAGTAGATGGATTTGAGTCTGGATTTTTCAATGG
129GCAGTACCAATTACTGAGTTCATCCTGAGTCCTACTCCTAATCTAGTGAC
130ACATTTCCTTATCTTTCAACTTTCCATAGAAGTTTCTTAAATGAAAAAGG
131GCATTTTTTTTTTTACTTGTTTGAAACTCTCTTTTCCCAGTCAGTTCCCC
132TGCTGCCTTGGCCTGTATTTGTGGCCTGTTAAATTTAAAAGTCTATCAGT
133TAGTCTAATTAGGATATTCAAATTTTAATTATTTTCCCTTCTCCACATGG
134GCAGCCACCCACCCTTCTTTTATTCTCTCTTTTTATTTCATTTAGGGAAA
135AAAGCTCTTGGCAGGATTGCTATAGAAACCAGCCACCAGGCAGACTAGGC
136CATTGTGCTTCTGGACACTGATACTCAAAGCTGATTATGGGTCTGGAAGC
137TTGCATGGCTGAGCAAGACTGATGGAGTTAAGACAAAGAGGGTCTCAGCT
138ACAGAGAAGGGGAAAATAAGCACCTCAGAACTTTAGACAAACCTCAGCCC
139TACCTTTATCTTTGCCCCTGTATGCTTCATGGAAGAAAAAAGTTAGAATG
140AGGAAGGCTGTCCCCTATTAAAGATGAATGTCTGGGTTGACATCAGAACT
141TGTGCCCTTAGGCTAACCCTGCCATGACGACAAACCCACACCTGTGAACA
142TGTCATTTTCACTGAGTATCCCTAGTTCCTATTAAATTACCTGGCATATA
143CTTAAGGTTCTCATAGTGCTTGGTGCTCAGCAATTCTGTAAGACAGAGCA
144CTACTAGTGAGAGCACACTGAGACTACCTTGGAACATGAGCAAGTGAAGA
145CTTCCTAACACACTGGATTTTTCTGGGAAATGACACTAATGAAAGCCTCT
146GCTATGTGCTCTAAGGCTCCCTGTTTGCAATTTACCTCCCCTGCCTTCTG
147GCAGTGGTGGTGTAAATGCCTGGTGGAGGGGCTTTGAAAGCTGTTAGTCA
148CTGAAGTACCTAAGTGTATTAGGCTATTATTGCCTTCAAGGATTTTCCCC
149TGGTCCCACAATGCACCCCTGTCTACATTAACAGGCTCCCACTCATTTAC
150ACTGGGAGAGCAGTGCTCCTGGACACATTGCCATAGCAACCAGAAGCCAG
151ACAGAGTAGGAGGGTGAGCCAGACATTTGACAGCAAAGGTTAGTGGAGTA
152TCTGTTGGAGAGGGGCTGACTCTTAGGAGGAAAATACCTTATCTCTCAGC
153TGCAGAGAAATAGGCCACTAGGCCCCTCAGTGTTCCAACACCATCCCCTC
154CCCATCCTCCATCCCCATGCCTCCAGATGAGGAGTAGTCAGAATGAGTTT
155TGTTTTATCTGGAGGCCAAGGCCTGTGTTTTATCAGAATAGGTATCCTTT
156GCCCCGAAGCCGGTCAAGGGAACCAGGTACCACATACTTCCTCCTACGCC
157ACCTTGTTACCAAACTAACACCCATGAGTGAACATATGCTCCAAATGTGt
158gttcccatgactgcatctcctgtgcctagaatagtgtcaagtatatggca
159gTGCAACTTTctgcacttcccctgtctactcactccattgcagttcacac
160cttatcatttgcagaattccatttactactggaatacccactgtattagt
161ctgtcctcatgctgctaataaagacatacccgagactggacaatttacaa
162cagaaagaggtttaatggacttacagtttcttgtggctggggaggcctca
163caatcacagctgaagatgaaaggcacatctcacatagtggcagacaagag
164aagagagcttgtgcagggaaacttctctttttaaaaccatcagatcttgt
165gagacttattcattatcatgaagaacagcacaggaaagaactgcccccat
166gattcaattacctcctaacgggtccctcccacaacatgtgggaattcaag
167atgagatttgggtaaggacacagccaaaccatatcagccacagtctcaac
168tgatgacactgagaacatgaaagtaaaggaatagcctttaaaaacttctc
169acttccatgcatctgcaacttgatactctgctttccctttcatcactatg
170gataaactctctacattcctatgaaaacccatacctaccgttggccacta
171gattacaccccttcttgactattcaatgcatggtcccagcaatgctgtct
172gtgctctttgccacatcatcaatttacctttatgtactggatgattccca
173tcagtacacaaagattccacaagtctcccttgcaacaacaacaacaaaac
174caacaagaaagaaacaaaacaccctaccttaactgtacaacccactccac
175ctactgcatcatctctgtacaccaaacttcctcaaaaatcattatgtggt
176cttgatttgttcacttatgtactctcatttttttcttgaacccaccctag
177tcaagcttttatcccccactccatggaaatagctcaagatccccaaataa
178cctgcatattgttaaacctagtgattatttctcaggctggtcttacttga
179ctgaaaagtagaatttgacacaattgatcacttcctcctccttgtaatac
180tttcctcacttaatttacaggacatttctgtctcttggttgtgcttctgc
181ttcagtgtctgccatttttcagagtcatggctagttactcctcactgctt
182tgacctcttcacCCTGCTAGAAGCTATTAGTCAAAACATAAGTTTTTATT
183TAGCCAATTGAAGGTGTGTAACATAGGACTGTGGTTGTCAGAATGGAAAC
184CACTTGGGCCTTCATATAGGTGGCTGAAGAAATTTATCCAAGCAAGAGAT
185AGCATCAGGTCCTGGGCTAACAGCTTTCTGGTTGGGAAAGACCCCCAACA
186CCTGCCTTCATTCAGTGAGACAATTGTATGACTCACCTGCAGTAATGTGC
187AGGTTAAAGGTAACGAGTTGAACTTGTAGCTTGCCCCTCTCTCACTACAT
188AAACTCCTTTCTTCTCTCTGGAAGGAGTTCAGTTTCCAGCAGAGGTGATG
189ACAGATTAACAGATTCCAGTTTAAAAAGTGCTATAACCCTGAAGGGGGTG
190GGGTATGTTGGTAGATAAGAGAAGTTAGATCTTTAATAAATCCCACAAAT
191TATTCTGGGCAATTTATTTACTGAGAATTTTTAACTCTCAAGTGTTAAGA
192TTTTCCTAGATAATCATTTGTTTAATTCAGGTTTTCAAAAGCATTTACTT
193CAGACTCCTTTTATTCTCTTAATTTCTTTTCTATTGCTGTTTTAAAAACA
194AACAAAAAAAATACTTAGTGACTCAATTAAAAAATATTATTGGTGAGGGG
195ATGAAGCACAGTTTCAAAGAGTTACAAATTAAAAATATTAATTGGCATCT
196GAATTGCAAGAATCCATTTACCTCCACTCTCTAAGCTCTAATGATGTTTG
197TGTCCCCAAGTCAAGTTCCAAAGTAACCATTATTCCCAATAGGTAAAATT
198CCTCTGACCTCTGGTCCTGTTGAACCTTAAGGCTTACCATAAAATTGCTT
199CAAATTGCAAGAAATGAGCGTGGAATTCTTCCCTCCCCCTAGCCAAGGCC
200TGTTCTAGTTACAACCAACAGTCGATAAATCCCAGTGCTTCTCCCATAGT
201CCCAACCCTCTCGTGCACTCTCACTACCTCATTGAGGGCTTTGGAGTTTC
202CAGGATACAGCATACGAGTCTTACCAAAATCCCAGATGGGGCACCTCTCA
203GTCATAACTTAAGAAGATGCTCTCAGATCTTGACTCCCAGATTCAGCCCA
204GACTCACTATGATCTTGAAGTGCCTTGTGAACTTTAACAAATGGCCCATC
205CTGTCCCCAGTCTCTGGTGCATAAACTGTTTCCCACATCAATCACGAGCA
206CAGGTTCTATGCCATCCAACACTGCATTGTTCCTTGACATGTTTTTTTTT
207TTTGTTTGTGCAGTCAACACATAATTGATGAGGCACATTCTACATGACAG
208GCACTACACAAGAGACTGAGGGGTGAACTGATTAGCACCCTGCCCCTTTG
209GTGACCTGTTAAGATATAATAATAATGGTCATACTGAGCTCTGAGAGTAA
210AATAAAAACAGCAGTACACTCAGGAGGGGCCAAAAATATTCCATTCCTTC
211CTTCCCCATCAACTTTTTATTTGTGGATCCTCAAGGCCGAATGATCCTGG
212AAGACCCCTGTCTGCATAAAGACATTTATTTGTGGCCTTTCATTTCAAGT
213AATTGAGTTTTGATATCTATACCAAACAAAGAAACGTCCAGACCCCCATC
214ACATTATAGCTTCCCCTAAACAGTTGTTTGCAACAAACAGGTTCAGTAAG
215TGACCAGTTATAAGATTAATATATAAGAAAATAGCTTTCCAGTGACTAAA
216ATCCAGCTGGAAGGGCAAGGAAGTTTTACTTCATTACTGCATCTCCTAAG
217AAGCTTACTAAGTCTCTGTTTCCCAAATATGTGAAAAGCAATAAGTTGCT
218TCTAGGGTAAGAAGCAATAATGTATGTGTATGGAATGAACTGGCATTCAC
219CTGAAGCTCAATAAAAGTTATTCCCTTCCCTTTGGAAAAAAAAAACCCAG
220TTCTCAAGGTGGGACTACAGAAAATGTTTGCTTTTCATCAATTCTTTAGG
221TAATTTTGAGCTTCATCTTGGGGCTGAGAATTTGGGTCAGGACCTATTGA
222GAATAGCCACCACTCACCTCAAAAGAGATCACATCAGGAGGTTCATAATC
223TGTTTCTATCTTTCAAGTATTCTTATTGCTTTTTCACATTTCTCTTTCAG
224TACCTTACAATGGAAATATGGGCATTTCATAAAACAGAACGAGATAGTCA
225TGTGCACAGCATTATCAGGGCCAAGCTTTGGAAAAATGGACTCTGATATT
226CAGGACAATATCCTTAGCAAAGGGCAATTTTGATTCTCAAACGCGGACCA
227GCAAAGTGCTTTGCAGTCTAATGATCCAAGCCTACCTCCAGTTTTTCTTT
228TGACATCTGAAGCCTTGAACTGATTCCGGTTGCAACCACTTTACAATGAA
229GGTTTTAAAATCCCTAACACACAATTCTATCAACCCTTACTCTTCAATCA
230GTCAAGTACCCTACGTTTCCAATCCTAGAAATTAGGCTGCCTCCATTCCC
231TGATATATAGAATGCTTTCAAATTTATAATCCAGTGCCAAGTCTTGCTTC
232CATCCCTGACTTTTTTACTTTCTTAAGAATCAGAAACCATGAAGAATTCT
233GGGCCCCTTGCTGATCAGCACAGTGCTATGAGAATTTCACAAGCCAAGGA
234CAGTACAGATCCAGAAATCCTGTTTTATAAACTGTGTCAAGATTCAAAGT
235CCATTTTCttttttattattattatactttaagttctagggtacatatgc
236acaacgtgcaggtttgttacatatgtatacatgcgcccttttggtatgct
237gcacccattaactcatcatttactctaggtatatctcctaatgctacacc
238tcccccctccccccaccccacggcaggcccccgtgtgtgatgttccccat
239gctgtgtccaagtgttctcattgttcagttcccacctatgagtgagaaca
240tgcggtgtttagttttttgtccttgccatagtttgctgagaatgatggtt
241tccagcttcatccatgtccttgcaaaggacatgaactcatccttttttat
242ggctgcatactattccatggtgtatatgtgccacattttcttaatcaggt
243ctatcattgatggacatttgggttggttccaagtctgtgatattgtgaat
244agtgtcacaataaacatatgtgtgcatgtgtctttatagcagcaggattt
245ataatcctttgggtatatactcagtaatgggatggcttggtcaaatggaa
246tttctagttctagatccttgaggaatcgccacactgtcttccacaatggt
247tgaactagtttacagtcccaccaacagtgtaaaagtgctcctatttctcc
248acatcctctccagcaccttttgtttcctggcttgttaatgattggcattc
249taactgttgtgagatggtatttcattgtggttttgatttgcgtttctctg
250atggccagtgatgatcagtattttttcatgtgtctgttggctgccgatcc
251cacagaaatacaaagtaccatcagagaatactataaacacctcaacgcaa
252ataaactagaaaatctagaaaaatggataaattcctcgacatatacaccc
253tcccaagactaaaccaggaagaagttgaatccctgaatagaccaataaca
254ggctctgaaattgaggcaataatgaatatgctaccaacccaaaaaagtcc
255aggaccagaggcattcacagccgaattctaccagaggtacaaagaggagc
256tggtaccattccttctgaaaccattccaatcaatagaaaaagagggaatc
257ctccctaactcattttatgaggccagcatcatccttattccaaagcatgg
258cagagacaaagcaaaacaaaagagaattttagaccaatatccctgatgaa
259catcgacgcaaaaatcctcaataaaatcctggcaaactgaatccagcagc
260acatcaaaaagcttatccaccatgatcaagttggcttcatccctgggata
261caaggctggttcaacatatgcaaatcaataaacataatccatcatataaa
262cagaatcaaagacaaaaaccacatgattatctcaatagatgcagaaaagg
263cctttgacacaattcaacagcccttcatgctaaaaactctcaataaacta
264ggtattcatgggatgtatctcaaaataataagagctatttatgacaaacc
265cacagccaatgccataatgaatgggcagaaactggaagcattccctttga
266aaactggcacaagacagggatgccctctctcaccactcctattcaacata
267gtgttggaagttctggccagggcaatcaggcaggagaaagaaatacaggc
268tattcaattaggaaaagaggaagtcaaattgtccctgtttgcagatgaca
269tgattgtatatttagaaaaccccatcatctcagcccaaaatctccttaag
270ctgataagcaacttcaacaaagtctcaggatacaaaatcaacgtgcaaaa
271atcacaagcattcatatacaccaataacagacaaacagggagccaaatta
272tgagtgaattctcaAAGTCCATTTTCttttttttaaatattattatacaa
273gtttaatatataGTCAAATGCACAACAATTTATCCTCTGGATTGGGAACA
274AGAGATTTCTAGACATCTCAGCTTTAGCCAGTTTATTATACACCTACTGC
275TTCATAGTTGAGTTCTTCCAGAATATCTGTTAGAACCCCTGATAGCATAC
276TATTTTGTGATGAGATAAATACTTTAAAAATTATATGATCACAGTAGCAT
277GGAATGACATTTCCTTAATGCTATGTTTGAGGGCCTTTTTCTTGTTTCTG
278CTAGTAGAATCTGTTCTACCATTACTTATATACAAACATTATTTATTGCC
279AACATGATACACATTATATGGTGTGGATCCAGTAAATATTTGTAAATTAA
280CTGATTTGGCACCCCACAATATCTCAAGACATGAGATTTAAGAAGAAAAG
281AGCTTGACTAGTAAACCTGGTAGAGAAAATGCCTTTATACAGTTAGTATA
282TCCCACAATACTATCAACAAGTAGATTGGATTTTATTGTTATAACAGAAT
283TGAGTGAGATTGTGAATAATAAGAAAGTTGAGTTGTGGTGCATTGTCCTT
284AGAAGTTTCCTTCCTTTCTTTCCTTCTGTTCAGTGTTGTGACCTCAAATA
285AGGGGCACAGATGCCTCCTCGGGCAGCTTGGGGCAAGTGATCTACTTTCT
286TTTTTTTTTCTTTTTTAAAAttttattattattatactttaagttttagg
287gtacatgtgcacaacgtgcaggtttgttacatatgtatacatgtgccctt
288ttggtgtgctgcacctattaactcatcattaagcattaggtatatctcct
289aatgctatccctcctcactccccccaccccaccacagtccccggtgtgta
290atgttccccttcctgtgtccatgtattctgattgttcaattcccacctat
291gagtgagaacatgcggtgtttggttttttgtccttgtgatagtttgctga
292gaatgatggtttgcagcttcatccatgtccccacaaaggacatgaactca
293tcattttttatggctgcatagtattccatggtgtatatgtgccacatttt
294cttaatccagtctatcattgttggacatttgggttggttccaagtctttg
295ctattgtgaatagtgctgcaataaacgtacgtgtgcatgtgtctttatag
296cagcaggatttataatcctttgggtatatactcagtaatgagatggctgg
297gtcaaatggtatttctagttctagatccctgaggaatcgccacaccgact
298tccacaatggttgagctagttcacagtcccaccaacagtgtaaaagtgtt
299cctatttctccacatcctctccagcacctgttgtttcctgactttttaat
300gatcaccattctaactggtgtgagatggtactcattgtggttttgatttg
301catttctctgatggccagtgatgatgagcattttttcatgtgtcttttgg
302ctccataaatgtcttcttttgagaagtgtctgttcatatccttcgtccac
303tttttgatggggttgtttgtttttttcttgtaaatttgtttgagttcatt
304gtagattctagatattagccctttgtcagatgagtaggttgtgccatccc
305catcaagctaccaatgactttcttcacagaattggaaaaaacttctttaa
306agttcatatggaaccaaaaaagagcccgcattgccaagtcaatcctaagc
307caaaatatcaaagctggaggcatcatgctacctgacttcaaactatacta
308caaggttacagtctgacacacagagctagtgaaatttaggcagagcaact
309gcacaggcatgtgcagagaccaggagccttagatacttgggctttctggg
310ctcccctaaaaaagtagttgcaactcaagcaaagcaggaacagacccccg
311tacataccctaggaaagaggctgaatccagggggccaagcagcaacagtc
312tacaggccccacttccatggcatctcacaggataagacccagtggcttgg
313aattccagccaggcaccggtagtagtgttacacctctctgagacagagct
314cctgtggagaggggccaggggccaacctccatctttgctgtttggacaac
315tttgctgtttcagccttcgagctttggagagtccaagccaaccgggggtg
316gaagggactcctgagcacagcacaactgctctgtgaaaatgtggccagtc
317tgcttctttaaatgggtccctgatcccattccttctcactgggtgggacc
318tcccaactagggtctccagccacccccaccactgttatctggctaaacag
319ttttgaaacctccttaggatagagctcccagagagaaaagtgaaccgaca
320tctttgctgtttgtgtgacaaccattccagccttcaggttttggagagtc
321caagctgaccaggggagaaagggattacccaacacagcacagctgttata
322caaaaacatggctagactgctgtttaaaacaagtttccaatcccgttcct
323cctcactaggcaggacctcccaaccagaacctccagccaccctcgagggt
324gttctttggccaacagagatccgaatacttcctcagttggagctcccaag
325gggaggggcaggcctccatctttgctctttgggtgacttagctgtttcac
326ccttttcgctttgagattctgaggtgacaaaaggctgaagcagacaccca
327gcacagcagagctgctctatgaaaacatggcaagactgatttttaaagca
328agtctctgatcctattcctcctcactggaggtgacctcccaactggggtc
329tccagccagctccttcagatgcattcaggctggcaaaaagtccatacctc
330cctgggatggaggtcccagagggaggggcaggttgccatttttactgttt
331tgcagcctttggtggtaatacctccaggtaccagaaactccaaggtgact
332agcaactggagtgggcatccagcataccacagcaatccggcaaagaaaat
333gtctagcctgttacattggtatctgtttccatatctcatcaccaggcaag
334tcttccagacctgggcctccagccatcatctgccagagatactgagccag
335tagcaactttacaactccctggacagagtttccaggggcaactgaaagtc
336tttctaccactgcctctgtagtggacctgtctttgctaaccttggactaa
337caaaggagtaaaaaccctacctaagtgccttatccacacctccaacaagc
338tgcagttgacccaagaagaggaggccagtttgtctccaatgggtcctaca
339caccccctgctgctcatcaccagacaaggaacccctggcttgggcccaca
340gcacaaaccctccatcctaggctgatttcactgcacaattgctgacccac
341atttctctggggtggagcccccaggaggcaagcaaagtggtggcacagca
342agccagctgatatggagcccagagggtttagtgttggagcatctgtagtg
343gagtgtggccaggtacggccatccctcttggctcagcttgctcccataag
344agacttcagacctaggggaatggtcagatctgatctctgccatgcagtct
345tgcacaccagatggggctgatccaacctgagcactccttggtctcctggc
346ctctttcagggtttcaccctggacactccagcttacaaggcagtcttgga
347tgccctggggacacacaccttaccttctgcactagtagactgcgcctgat
348cagtggagagtgccaaaaatgtggcccctatggccctgcacagcctgcat
349attccatcctcatactgcagctttcctcaagtccatggcaactctccaca
350tccctttgctggcacctgtctgcatgagtaggttttgcttcacatgctct
351gccaacacacgggattgcagtacacccccaccacctccactgaacaccaa
352tgaagatgaagccttagtgggcacagagccagcaagccccacccccacca
353gcacctagcccctgtgctaatgctgcacagagaacaaggtatcctcccac
354accccgagtgatcactcctgcttgcagggaacaaagaaggcacccagacc
355tgtgctggccaacaaccttccaaaagccaataccacctccactgcaacag
356tgcacacaatcttcagcaggggctttctgctccccaccacccccagctgc
357ctagcctctgccactgtggtaaatgcctgcaggaaggcaggtacccctgt
358atttgctaacactcttgctgcagctgctgcacattgggccccacagcaca
359gtggactgcaaacctcatggaccagagaacaaagtcagggccccagagtt
360agcatatgtaggccaggggttgggagctgagcactggccccctaaaagct
361ttctgaaatgaagccatttggctgaatcaaacttgtacctcaatcaaacc
362atcaaggtcatgaataaaagaaaagaaaagaaaagaaaagaaaagaaaag
363aaacccagccaaaggtcagcaacctcaaagattgtaggtacataaaccca
364caaatatgagaaagaatcagtgcaagaacacaaaaaactcaaaaagccag
365agtgccttctttcctacaaatgaccatatcacctgtccagcaagggttca
366caaccaggctgaggctgagatggctgaaatgacagaagtagatttcagaa
367catgaacaggaatgaagttcattgagctacaagagtacattgtgacccac
368tgcaagaaagctaaaaattatgataaaacattgcaggagctgacagacaa
369aatagccagtatacagaagaacacaattgacctgacagagctaaaaacac
370actacaagaattttataattctatcacatgtattaatagcagaatagacc
371aaatggaggagtctcagagcttgaatactgtctttttgaaataagacagg
372cagacaagaatagagaaaaaagaataaaaagaaatgaacagagcctccaa
373gaaatatggaattatgtaaagagattgaatctatgacgggctggtgtacc
374tgaaagagatggggagaatggaaccaacttggaaaacatattttaggata
375ttatccatgagaatgtccccaatgtagctaggaaggccaacatacaaatt
376caggaaatactgagaaccccagtaagatataccacaagaagatcatcccc
377aagacacaatcatcagattctccaaggttgaaatgaatgagaaaaatgtt
378aaagacagctagagacaaagctcaggtcatctacaaaaggaagcccattg
379gactaaaagtggatttctcagctaaaaccctacaagccagaagagatttg
380gggctaatattcaacactcttaaagaaaagaaattcaaaccaagaatttc
381atatctggccaaactaaacttcataagcaaaggagaaatcagatcttttt
382cagacaagcaaatgctgagggaaattgttaccaccagatctgtcttacaa
383gaactcctgaaggaagcacccaatatgcaaaggaaagactgttaccagcc
384actacaaaaacacactgaattacacagtccagtgacactataaatcaacc
385acataaacaagtctgcaaaataaccagccagcattatgatgacaagataa
386aagacatatcaatactaaagttgaatgtaaatgggatacatgccccaatt
387aaaggtcacagagtgtcaagctggataaagagccaaggcccattgctatg
388ttgccctcaagtgacccatctcacgtgtaatgacacacactggctcaaaa
389taaagggatggagaaataccaaccaagcaaatggaaaacataaaaacaat
390cctagtttctgacaaaacagaatttaaaacaacaaagatcaaagaagaca
391aagaagggcatcatataatggtaaagggttcagttgacaaagataatcta
392gccattctaaatatatatgcactcaacacaggagcacccagtttcataaa
393gcaagtacatagagactttcaaagagtcttagactcccactcaataacag
394tgggagactttaacaccctacagacaatattagttcaatcattgagacag
395aatattaacaatgatattcaggacttgaactcagcactggatcaaatgga
396cctgatagttatctccacaacttttgacctcaaaccaacagaatatacat
397tattctcatcaacacattgcacttactctaaaatcaatcatataatcaga
398agtaaaacactccttagcaaacgtaagataactcaaatcataacaaacag
399tctctcagaacacaatgcaatcaaattcaaaatgaagattaagaaattta
400ctcagaactgtacaattacatggaaattgaataacctgctcctagatgac
401ttttgagtaaataatgaaattaaggcagaaaccaatatggtttttgacac
402taatggaacaaagagacaacataccagaatctctgggacacagctaaggc
403agtgttaagaggaaaatttatagcactaactgcccatgttaaaaagttag
404aaggatctctagttaacaacctaatgtcacaactaaaagaattagagagc
405caagagaaaacatattttaaagctagcagatgataagaaataaccaaaat
406tagagctgaactaaagaatataggcattaaaaaaacattcagaagatcaa
407agaatccaggagctttttttttttgaaaaaattaattaaatagatagact
408gctagctagatcaataaagaagaaaagagaaaagactcacgtaagaatgg
409cgtgaacccgagaggtggagctggcagtgagccgagatcgtgccactgca
410ctctagcctgggtgacagagcgagactccttctcaaaaaaaaaaaaaaaa
411aaaaaggaaatgacaagggggatattaccactggcaccacagaaatacaa
412acaaccatcagaaaatattattaattcctctatgtacataaactagaaaa
413tctataagaaatggataaattcctgggcacatacaccctcccaagactga
414accaggaagaaattgaaccgttaaacaaacccataatgagttctgaaatt
415gagacagtaataaatagtctacgaaccaaaaaaagctcaggaccagaaag
416attcacagctgaattctaccagatgtacaaagaagagccagtgccattcc
417cactgaagctattcaaaaaatggaaaagaagggactcctctgtaactcat
418gctatggggccttcctaactgatgttattggtctgaaaacttcagaccag
419tattcagcatcatcctgatgccaaaacctgtaagagatactacaaaaaaa
420gaaaacttcagagcaatattttttatgaatatcaatgcaaaaattcacca
421caaaatactaggaaactgaatccagcagcacatcaaaaagcttatccacc
422aggatcaagtaggttttatccctgggattcaaggtttgttcaaaatatgc
423aaatcaataaatgcaattcatcacataaacagagctaaaaacaaaaacca
424catgattagctcaatagatgcagaaaaagctttaaaaaaaatttaatatc
425tcttcatgttaaaaactctcaataaattatatattgaaagaacatacctc
426aaaattataagagccatttattgcaaacccacaggcaatatactgaatgg
427gcaaaagctggaagcattccccttgaaagccggcagaagacaaggatgct
428ctttctcaccactcctattcaacataatattggaagtcctggccagcgca
429atcaggcaagagaaagaaagaagggacattcaaaataggaagagaggaac
430tcaaattatccctttttgcaggcgatatgatcctatatctagaaaattct
431atcatctcagcccaaaagcttcttaagctgaaaaacagcttcagcaaagt
432cttaggatacaaaatcaatgtgcaaaaatcactaacattcctataccaac
433aacagtcaagctgagagccaaatcaagaatgaactttcaatcactattgt
434cacaagaaagaataaaatacctagcaatacagcttactaggaaggtgaaa
435ggtctctacaaggagaactacagaccactgctcaaagaaatcagagatga
436cacaaatgaatgaaaaatatttcattcattcattcattcatggataggaa
437gaatcaatgtctctaaaatggccatattgcccaaagcaatttatagattc
438actgctgttcttatttttaaagccattgagattcttcacagagctagaaa
439gactattttaaaaaccacatgaacagagctagaaaaaactattttaaaaa
440tcacatggaaagaaaaagcacaagtggttaaggaaattttaagcagaaag
441aacaaagcctgaggcattacaccacctgaatttaaactactctacagggt
442tacagtaaccaaaacagcatagtactggcacaaaaatagacacataggcc
443aatggaacagaatggagaatccagaaaaaaagaccacacccctacaacta
444cctgatctttgacaaacttgacaaaaacaagcaatggggaaaggattccc
445tattcaataaataatgctagtgtaactggctaggtggatgcagatgattg
446aaaccggactccttctttacactatatacaaaattaactcaagatgtatt
447aaaaatacttaaatataaaactgaaaacaagaaaaaccttgaaagtcaac
448ataggcaatgtcattcggggcataggcatggtcaaataattcatgacaaa
449aatgacaaaatcaattgcaaccaaagcaaaaattgacaaatgggaactaa
450ttaaactaaagagcttctgcacagcaaaataaaccatcagcagaataaag
451agacaacctaaagaatgggagaaaatgtttgcaaactatgcatctgataa
452aggtctgctattcagcatctataaggaacttaaataaatttacaagaaaa
453aaaacaaactcattaaaaagttggcaaaggacatgaacaggcaattatca
454agagaagacgtacgtgtggccaaaaactgtatgaaggaaagctcaacatc
455actgatcattagattaatgcaaatcaaaatcacaatgagataccgtgtca
456caccagtcagaatgtctattattaaaaagtcaaaaataatggatactggc
457gaagttgtgaaaaaaaggaatgcttatacaattttggtaggagtgtacat
458tcattcaaccattgtggatgacagtttggttattcctcaaagacctaaag
459acagaaatactacttgacccagcaatcccattactgggtatatacacaaa
460gagatatacatcattctattataaagacacatgcatgcatatatattatt
461gcagccactattcacaatactaaagatatgaaatcaatctaaatgaccat
462cagtgatagactggataaagaaaatgtggtacatatgtagcatggaatac
463tatgcagccataaaaaacccaaaattacgtcctttgcaagtacatggatg
464gagctggaggacattatcctcagtatactaatgctggagcagaaaaccaa
465gcaccacatgttctcacttataagtgacagctaaatgatgagaacacatg
466gacacatagaggggaacaatacacactggggtctatcagaaggtgaagat
467tgggaggagggagatgatcaggaaaactaactaatggatactaggcttaa
468tacctgaatgatgaaataatctgtacaccaaaccccccatgacccaagtt
469tacctatgtaataagcctgcacatgtattcctcaacttaaaaattaaaaa
470taaaTATATAgaaaaaaagaagtcacaaaagacaatataatgcatgtctc
471cttttatatgaaatgtctagaatagaataatttatggatacagaaagtat
472acttatggttgcctaggtctcaagaaagaagtgaatggggagtgattgct
473aatggatatgggttttatttttgtaatgactaaaatgttctaaataagat
474tgtgatgatggttgtacaagtctgtaaatacactgataaccattgaatta
475tacactttaaataggccaataacatagtatgtgaattatatctcaataaa
476gcagttaaaaTACATAAAAAGAATAATAGATTTTCATGTTCCTTTACACT
477AGCTATTGGCTTGCCGACTGGTGTTTTCAAATCCTGTTGATTCAAGTGCA
478AATGTATATGCATCACTCTGGGTTTTCTCTAGAAAATATTTGCTATGACC
479TTAAAACTTTGTGTATCTTCTGACCCTGAAGATGTTGTCTAATGGAAATT
480ATTGTAAGGCAATAGTCGTTTATGAGAACAAAGTTTTTACTCTCATAATG
481CTTATCACAGTGATACCCTGCAAAATTATTAAAACATAAAACATATCATT
482TCTGTTGCAAGAAGAAATGATAGAACAGCTCTAAAATGTAAATATATGTC
483TCCATGAGACGATAGCAGTAGCTTAGAAATCAATGTGGAgacaggattaa
484tcacctgccaagtaaagatcccctgggccatgagtaatcagcaacaatat
485ccaggcagtacagtactttccatgggccttgggttagacacagagactta
486atagcttcagatttgacccagcacattcccagctctggtggctatgcggg
487aaagactctttctgcttgaggaaatatgagaaaagagtaaaggggacttt
488gtcttgcagcttggataccagcttggccacagtgaggtagagcaccaaga
489gggcaattgggtttttcaataccaggcactggtttgtggaaggcatttat
490gaaacttcccttgtacagagggtaactcgcttcctggaagggagggttcc
491agtccaggcagtactcaccatggtcctggggtggtggtggccagagagag
492aaactccaattcttgtgaaaaggggaagaaagggtaggaatggctttctc
493ttgtggcttgggtgccacctcagccacagtaaaccagggtaccaggtaga
494ttcctaagattgctgattccaggctctggctcctggatgacaattctgga
495cttgcctgaaaatgggaacttgccaacttgtagggatggacagaagcctg
496gctggctttgctacctgctgattatacagctctagaagtttgagcagacg
497taggtgttaggtagatcattgttaccatgggccttaggggagaaacagcc
498ccttgctggcttcaggtttgagcaagcacagttcaagtgatggtggccac
499aagggttctaatgtccctcttccccaagctccaggcagctctgcaagaca
500gaggctccatttatttggaagaaagtaagaaaagggaacaagagcctttg
501ccttgtaatacagagaattcctttggattgtacccaagaccaccaaggcg
502gtacatctactactcttcaagagtcatggcattactgtgcttggggtacc
503tcctaatgcagatatggctgcagtggccagaaacttagattacaaaaccc
504aagtcccttcaaatacctcgaaagactttccaagaagaatgggtacaaac
505aatcccagactataaagactacaataaatactcaactcttcaatgtccag
506acatcaaggaatatccacaaacataaacaacaagactaacctggaaacat
507ggccttaccaaacagcctaaataaggcaccagggagcaatcctagagaga
508gagacatgtgacatctttgaaagagaatgaaaaataattgttttgaggaa
509agtgaacgaaattcaagatatcacagaggaaaaattccgaatactatccg
510ataaatttaacaaaaagaatgaaataagtgaaaagaatcaagcagaaaat
511ctggagctgaaaaataccattgcaatacggaagaatgcatcactctctct
512ctttttttttcttttttttaattatactttaagttttagggtacacgtgc
513acaatatgcagatttgttacatatgtatacatgtgccatgttggtgtgct
514gcaacaccatggaatactatgcagccataaaaaaggatgagttcatgtcc
515tttttagggacatagatgaagctggaaaccatcattctcagcaaactatc
516gcaaggacaaaaaaccaaacaccgcatgttctcactcataggtgggaatc
517gaacaatgagaacacatggacacaggaaggggagcatcactctctcttac
518cagcaaaactgatcaatcagaggaaagaaatgctgagcctggagacaggt
519tatttgaaaatacacagtcagaggagacaaaagaaaagagaataaaaaag
520aatgaagcacacctacaggatctagagaataaccttaaaagggcaaatcc
521gtggtattgatcttaaacaggaggtagagaaatagatggggatagaaagt
522tcattcaaaatgatgataacagaagatttcccaaaaccacagaaaaatat
523caatatttaaatagaagtacaagcagatttaacccaaagaagactacctc
524aaggcaattaatactcaaacacccaaagatcaaagggtcttaatagaaac
525aagagaaaaaaataacatataatggagcttcaatatgtctggcagcagat
526tttttagcagaaattttataggccatgagagaatgacatgacataacata
527tttaaaatgctaaaggaaaaaaTCATGCATCATTTTTTTTAAGTTTTCAC
528CCTAGTCTCCTTTTATATTTTATAttattttattttattatactttaagt
529tttagggtacatgtgcacaatgtgcaggttagttacatatgtacacatgt
530gccatgctggtgtgctgcacccattaactcatcatttagcattaagtata
531tctcctaaagctatccctcccccatccccccaccccacaacagtccccag
532agtgtgatgttccctttcctgtgtccatgtgttctcattgttcaattccc
533acctatgagtgagaacatgcggtgtttggttttttgttcttgcgatagtt
534tactgagaatgatgatttccaatttcatccatgtccctacaaaggacatg
535aactcaccattttttatggctgcatagtattccacggtgtatatgtgcca
536cattttcttaatccagtctatcattgttggacatttgggttggttccaag
537tctttgctatcgtgaatagtgccgcaataaacatacgtgtgcatgtgtct
538ttatagcagcatgatttatagtcctttgggtatgtacccagtaatgggat
539ggctgggtcaaatggtatttctagttctagatccctgaggaatcgccaca
540ctgacttccagaatggttgaactagtttacagtcccaccaacagtgtaaa
541agtgttcttatttctccacatcctctccagcacctgttttttcctgactt
542tttaatgattgccattctaactggtgtgagatggtatctcattgtggttt
543tgatttgcatttctctgatggccagtgatggtgagcattttttcatgtgt
544tttttggctgcataaatgacttcattgagaagtgtctgttcatgtccttt
545gcccactttttgatggggttgtttgtttttttcttgtaaatttgtttaag
546ttccttgtagattctggatattagccctttgtcagatgagtaggttgcga
547aaattttctcccattttgtaggttgcctgttcactctgatggtagtttct
548tttgctgtgcagaagctctttagtttaattagataccatttgtcaatttt
549ggctttggttgccattgcttttggtgttttagacatgaagtccttgccca
550tgcctatgtcctgaatggtaatgtctaggttttcttctagggtttttatg
551gttttaggtctaacatttaagtctttaatccatcttgaattaatttttgt
552ataaggcgtaaggaagggatccagtttcagctttctatatctggctagcc
553agttttcccagcaccatttattaaatagggaatcctttccctgttgcttg
554ttttagtcagttttgtcagagatcagatagttgtagatctgtggcattat
555ttctgagggctctgttctgttccattgatctatttctctgttttggtacc
556agtaccatgacgttttgtttactgtagccttgtagtatagtttgaagtca
557ggtagcatgatgcctccagctttgttcttttggcttaggactgacttggc
558aatgcaggctcttttttggttccatatgaactttaaagtagttttttcca
559attctgtgaagaaagtcattggtagcttgatggggatggcattgaatcta
560caaattaccttgggcagtatggccattttcatgatattgattcttcctac
561ccatgggcatggaatgttcttccatttgtttgtatcctcttttatttcct
562tgagcagtggtttgtagttctccttgaagaggtccttcacatcccttata
563agttggattcctaggtattttattctctttgaagcaattgtgaatgggag
564ttcactcatgatttggctctctgtttgtctgttattggtgtataagaatg
565cttgtgatttttgcacattgattttgtatcctgagaatttgctgaagttg
566cttatcagcttaaggagattttgggctgagacaatggggttttctagata
567tacaatcatgtcatctgcaaacagggacaatttgacttcctcttttccta
568attgaataccctttatttccttctcctgcctaattgccctggccagaact
569tccaacactatgttgaataggagtggtgagagagggcatccgtgtcttgt
570tccagttttcaaagggaatgcttccagtttttggctattcagtatgatat
571tggctgtgagtttgtcatagttagctcttattattttgagatacggccca
572tcagtacctaatttattgagagtttttagcatgaagggttgttgaattgt
573gtcaaaggccttttctgcatctattgagataatcatgtggtttttgtctt
574tggttctgtttatatgctggattacatttattgatttgcgtatattgaac
575cagccttgcatcccagggatgaagcccacttgatcatggtggataagctt
576tttgttgtgctgctggattcggtttgccagtattttattgaggatttttg
577catcaatgttcatcaaggatattggtctaaaattctcttttttgcttgtg
578tctctgcccagctttggtatcaggatgatgctggcctcataaaatgagtt
579agggaggattccctctttttctgttgattggaatagtttcagaaagaatg
580gtaccagttcctccttgtaccccttgtagaattcggctgtgaatccatct
581tgtcctgggctctttttggttggtaagctattgattattgccacaatttc
582agagcctgtttttggtctatttacaattaaaagaactagaaaagcaagag
583caaacacattcaaacgctagcagaaggcaagaaataactaaaatcagagc
584agaactgaaggaaatggagacccaaaaacccttcaaaaaattaatgaatc
585caggagctgtttttttgaaaggatcaacaaaattgatcgactgctagcaa
586gactaataaagaagaaaagagagaagaatcaaatagacacaataaaaaat
587gataaaggggatatcaccactgatcccacagaaatacgaactaccatcag
588agaatactacaaacacctctacgcaaataaactagatttcaccaacagca
589gaactgtcctacagttctacagctaaaaggagtttttcagtctgaaacaa
590aaggatgttaatgagcaagaacaaatcatctgaaggtacagaactcactg
591ataatagcaagtaaacacaaaaacaagaatattataacactattattggt
592gtgtaaattactgacatcttgagtagaaagactgaaactaaagcagtaaa
593aaataataaccacaacctttcaagacttaagcagttcagtaagatgtaaa
594tagcaacaacaaaaacttaagaagtccaagaatgaaattaaaaagtgtag
595agttgttggggtgggtgggagggatagcattaggagatatacctaatatt
596aaatgacgagttaatgggtgcagcacaccatcatggcacatgtatacata
597tgtaactaacctgcatgttgtgcacatgtgtcctcaaacttaaagtataa
598taaaaaaagtgtagttgatattggttgcctttttgcttgttagtttcttt
599atgcactcagttttaagttataattactttaaaataccgagttataagat
600agtatttgcaagcctcattctaacagcaatgcacacacagaaaaaagcaa
601gaaattgaaatacaccaccagggaaaattatcctctaaaggaagacaaga
602aggaaggaagaaaaagagaggatcacaaaacaaccagaaaaaaatcaaaa
603tttcaggagtgagacctcacttatcaataatagcattcaatgtaaatgga
604ctgagcacttcagtcaaaagacaaagagtagatgcatggattaaaaaaaa
605aagagacctaagaatctgttgcctacaagaaacaaacttcacctataaaa
606cacacatagagtgaatataaaggatgaaaaaagatattccatgccattgg
607aaaccaaaaaagagcaggagtagctatacatatatcagacaaaatagatt
608tcaagacaaaaactttaaaaagagacaaagaatgtcattatgtaatggta
609aaggggtcaatccagcaaaaggatatgtaaatatatatgcactcaacact
610ggagaatcaagatgtataaagcaaacattattagagctaaatacagagat
611aggctacaatataataagaacaggagactttaacttcctctttcatcatt
612ggacaaatcatttggacagaaaatccgcaaggaaacatcaggcttaatct
613gtgctatagatcaaatggaccagatagatatttatagaacattttatcaa
614atggctgcagatgcacattcttctcagcacatagattattttcaaggata
615aatcatattttaggctaaaaaacacgtcttaaaaattaaaattaaaatta
616aattttatatcaagtatcatctcagacttcagagatgacgcaaaactaga
617aatcaataacaagagaaatttggaaactatgcaaatacatggaaatttta
618aaaatgtgtttctgaatgaccagtggatcaataaagaaattaaaaaggaa
619ataaaaaatttttgaaacaaatgataatggaaatacaacataacaaaacc
620tatgggataccacgtatgcagtattaagagggaagtttgtatctgtaagt
621gcctacatcagaaaattaaaaaaacttcgaataaacaaccaaatgatcca
622tcttcaagagctagaaaagcaagagcaaagcaaattcaaaattggtagaa
623gaaaggaaataataaagatcagaacataaataaataaaatggaaacaaat
624aaaacaatacaaaagatcaacaaaatgaaaagtttgtcttttgaaaacat
625aaaaaaattctcaaacctttaccttaaaaaaaaagagaaaaaacccaaat
626gaataatatgagaaatgaaaaaggggacattacaactgataatacagaaa
627ttcaaaggatcattagaggctactatgagcaactgtatgccaataaattg
628gaaaacctagaagtggataattttttagataatgcaacctaccaagattg
629aacctagaagaaatccaaaacatgatcagagcaataacaagtaatgagat
630caaagccataatcaacgtctctcagcaaagaaaagtcttggacctgatag
631cttcactgctgaaatttgacatttaaagaagaactaataccaatcctatt
632caaactgttctgaaaaataggggaatgaatacttccaaactcttggtaca
633aggacggtattaccctgataccaaaaccagaaaaagacacatcaaaaata
634gaaaaccacaggccagtattcttgatgaacattgacacaaagattctcaa
635ttaaatactagcaaaccaaatataatgacgtattaaaaagattattcatc
636ataaccatgttggatttatcctagggatgtaaggatggcttaccacatgc
637aaatcaatcactgtgatacatcatgtcaacagaatgaaatttcaattgat
638gctgaaaaaaattggacaaaatggaacatccctttatgataaaaaaaaaa
639aaccctgaaaaacttggtacagagggaacatacctgaacacaataaaaga
640catatgtcacagacacacagctagtatcatactgagtagggaaaacctgc
641cagctatatttttctgagatctaggacatgacattgatgcttactttcat
642cattgctgttcaacatggtactggaagtcctagctagagcaggcaagaaa
643aagaagtaaagggcatttatattggaaaggaagaagtcaaagtatgtttg
644tttgcagatgatataaccttatatttggaaaagtgtaaagattccaccaa
645atctattagaactagtaaacaaaattgcaggatacaaaatcaacttacaa
646aaatcagtagcatttctatatgccagcagtgaacaatctgaaaaagaaat
647tgaaaaagcaatcttatttaaaatagccacaaataaaataaaatacctag
648aaattaacttaaccaaagaagtgataaatcatggaagaaagattttacct
649tacctagagctgaaatggatttaggaagcttagcaaaatataaaagtaga
650agaatcaatggaaagagccctgtaggcgctcctggtttccagcttgagct
651tgtggaaatcatccttgtgtttatctcataggtttccttgggcgtacaaa
652gccattggaattaaggaagggccacagggtgaaagaagcttctagctgaa
653ctttgtactaattttgaccaaatgtgaattttcttgagcagaatcaatgg
654gcaaaggggaagtgcAAACTTTTTCtttctttcagggataccaataggtc
655atagttttggtctctttaggtaatcccatatttcatggaggcttgtttgt
656acttctttattgttttttctttattttgtttgactgagttatttcagaga
657gccagcctttgagcccggagattctttcctcatcttggtcagttctgctg
658ttaatactgtgattgcattgtgaaattcttgaagttagtttttaagtttt
659atcatatcactttgattctttctaaaagtggccatattgcctttcatctc
660ttttaccgtttcattgtatgccttagaaaccttggattaggttttgactt
661tatcctgaatttcaaggatctccattcctatccttattctgaattctact
662tctgccatttcagcctggttaagaaccattcctgggggaaaagtgcagtc
663ttttgaagggaagaagacactagctttcttagttgccaggcttcttgatc
664tgctttttttctcatttttgtgggctgatgtttcttcaataattgatgtt
665cctgtttctttggaaagcattgggtagatttttttgtcttctttgatgtc
666tttaggggtttggttgtggtagactcagtcaacagactttgtttctggaa
667gattttaggaggccaaggctcacctcaggactcctgggcctcatgtacta
668actctggggggctgatattaggtccccacctttgttctttggcttcttga
669tattaggaacctgctgtgctagaggggttgatgtattccaaggctggtgg
670ttacaacactccaatgggtggtgccaatcaaacacttcactgggtggtgg
671cagtagaatctatgctaattcccacctgccagcagtggtggaatcacagc
672atggtgcacactcattggctggataaggagtctggaaggcacagggttgc
673cagcttccatgtgggcatttatagtagcagtggtggtggcacagtatgtg
674ggaggggtggggctgttgatttccattcatgcattcatgttggtggcagt
675gttggtgtggaagcatgacaccggcagatatgaaactagtgccctccatg
676catgcattcacacaagcagcagtggcaacacagggtggaggccagggctt
677ctggtctctatgcacacatgcaagcaatggtggtgcagcaggagtgggca
678gggtgtgctcacatacagagtagtggcatagtggggtgcatacataaatg
679catgctggcagggaagggagttgaggtcaaccagcatgcacatgcactga
680caaagcaatgtcaggggtagctgtgggcaaatttgtgctgccaaaggggc
681acagaggaggctgtagttgggggagtgtgtgggtgggcttgtgtgcacca
682gtagaagctgctctgctggagctctgcaaatgtgaggcatggtctgtcag
683tgcaggaactgtgatgtgtgtctccaggaggcattccagctgggcaccca
684aggctgcactgcaagcatgtgcactaggggagtaaaggtgagccttgggg
685gatggacatccctggctgtactccactgacgacactcacacaccaaatcc
686cttgggttccacactggctggtcttctgcctctaccacttctctaagcag
687ctctgcctgccactacaagtgtccatgcaggttagggggtctcctgctgc
688cagaattccagagatccatggtgtgggcaggttgctcctcacctgctcaa
689cttaccttttccctgggagtggctggtggccaggaacaagtcccagtgca
690tggaagtcccttgcagggttcccaccttcctttctctatagcccagcatc
691tgagtcttccctccatcaattctcattgtctttcctccaaatatatgctt
692ggagtgtgccaggcttcccaatgtcctagtctcttggtggcagatatttc
693acttggctgcactgagtgagccaccttgccTATAATTTTTagaaggcttt
694taactagatattatctcatttatccatttttgctttggttgtctgtgctt
695gtgaggtactactcgaatctttgcctagtccagtgtcttggagaatttct
696gtgatattttcttgtagtagttttatagtttgaagtgttagatAATAATC
697AGACTCAACAAATGGCAGAATTCACAATTAATGAAACACACAATAGTAGA
698TCAATGTAAAAATAACTTTAAAGATAAATCTGGTTTAAATATTGAAAGAG
699ACGAAAAAGGGACTGTAATTTGTAAGACAAGAACAGGAATCTTCTTTAAC
700AATAAGGTATATTTTAAAAAAGAAACAACTGGAAATTTTATAAATGAAAC
701AGGTATGCACTGAAATAAAACCATTAATAGATTGCTCATATATTTCGACA
702GAGTCAAGGCTGAGTATTGAGTTAGAACACAGATTAgacaggggtcacat
703ctaattcatccctgtaccccagtgtctaatacaATAAGGCCAACATATAA
704CAAGTGTTTCAAAATTGCTTATTAAATTGAACTGGGTAAGTGGTCTTCAG
705ATAGGCCAGACATCTCTGGGCTTCTCCAGTGTATAGGGGTTTCAGGGGGG
706CAGGACAGCCTCAAGTGGAACTACCTGAGGGCTGGGCAGAGCTGGGTGTG
707GTTCCTCGTGGGTGGAGTAGGCAATAAAGGCTATCTAGAAAAGAGGTACT
708GGCTTTACCATTCACCTCAGGGACTAACTAGTTTGTTCCCTCTCAGAGCT
709GGAGAGTGAATTATCTTCATTCAGCACATGTCTGGCTACTATTCATCCTC
710CCCGTGTCAAAGAtacttaaagtagtgaaaacagatcttattcagtaact
711actaacaatgctgaaaaaagctgagctccattccaatttgtgcaaaggtg
712gtttgggcattttaaagggagaatgatgttgggggctgagtagagtcaga
713gaagtgaaaactacaaaatattggtcagtgtaaatgcactgtgtttaggc
714catctgtgtttgttagccggcagttatcaaagttaggatttgtccttcca
715cagagactggaagacagggttcctatctttcttgattacatttcaaagaa
716atggctctcaggtccttgggagagacatttctaaattgtaagagatacat
717attcactgtaataagcccttttaaataagtgctctaaaaaagggaggtca
718gggtcttatcatcagattttggcaagaacaaacagtatattttcctggca
719gcattgaactttctcaggcagtcattttagtggggtttggggtcaattat
720agggacccagccttaggctgtgagaaaccatgctagagtttagttagttc
721ccttactactacaggggtttggacagaagtgttagttccaggagttctgc
722agttctcCCCTGTTAGAAACTCTAAGGATGTCCATGGCTATATTTATGTG
723ACAAAACATTATATAAATGGTTGATGTTAACAACCTGCCAAAGATTATTT
724TTCTTACTCCCTCCCTCCTAGGCCTTTTGCAACCCCCACCCCCATTACAG
725AGAAAGGGGAACAATCCTGTGTGCAACCAGCTCTCCATACCTGGCCCCCA
726CAGCTGGATCTCAGGGTGATCTCCTTTACCACCTGGAATGATAAATACCT
727TCTTCCAGGACAGCAGCCCTCTTTATCTTGCAGAAGGAGGCAATCCAGGC
728TGGGTCCTTCGCCAGGGTACCATTTTCCTGCAGCCTCTACAGGAAAATAA
729GCTCGTCTGAGCTGTGGCCTGAGCAGGTCAAGTCTTCAGTAGAGAGGTCA
730ACTTTAGAAACAATGGCTATTCTTGTGTCTTCCCTTTCTCTATCCTCCTT
731CCCTTCTATATTACCAAAGAAGTGAACACTTAGAGGACAGAAACTTTATC
732CTGTCTAGCCCATGCCAAAGAAGATGTTCTCAAGAGAAGAACAGTTTGAA
733AGAGGCTGCTTGGACCTTAGGCCTCAGCTCCCAACTCCCTCCCTAACTCT
734TTCCCCTTAGAAAGGAAATCATCCTCACTGACTGAAGCCCTGAGTGGCAA
735GTCAGCAGGTGGTTTCCTGTAGGACACTGAGGTCTGCTTAAATAGACCAC
736CCATATGCTTCCATAAAAATATCTTGTGTATTGGAGTCTACAAATAATAT
737ATTCTTGATGCACCTAAACCTCACTAATTCATAACCACCTGGGGTTAACA
738TTTGCCTGAAGTATTTTCTAAAGAAAACAAAGACTAGTGATTCTAACAAC
739CCAGATGTTGTTTGACTTCAGCTACCCAGGTGTTGACAAGTAGTAGTTTT
740AAAAGCAGTTGTATGGCATGGAAATATCACTAGACTAAGATACAACTGGT
741TTGGGTCACAGTTCTGAAATCATCAAATGGTAGATATGTGACTGGGATTT
742TCTATCAATTTATTGAAAACAGCATTAAGTggcctagaaagatgtgagta
743actttcccaagttcacacagctagtaagtgacagaaaaagtaccgtccag
744atctagagttcttaaccattccaaatatattgccccatccTTATCAGGTG
745CTTGTTTATTCCTATGGTTTCTAGAGAGCAAAAGTATTAATATTTCAGGG
746TACACTTTTTTGCAACTTTTTTTGGCAACTATCTTCAAATCCTGCCTGCA
747GAGAATTCCTAAAGATATTGTTGAGCACTCATTGAGATGGAAGACAAACC
748CTGTTCAACGAGAAATCTTACTGTCTGGAGATCCCCTCTAAGAAAGAAGA
749AGGAGACTGCAGGGGTCTTGTCTGAACATGAAAGACACTTATGAGTTGGt
750ctagattgtcagtattggaggatttaggggcagcaatccttggggcaggg
751ggaatttccttgaaatccacatatgccagtctagctcagcttttgcttgg