PageRenderTime 37ms CodeModel.GetById 25ms app.highlight 5ms RepoModel.GetById 1ms app.codeStats 1ms

/test-data/emboss_sirna_out.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 158 lines | 158 code | 0 blank | 0 comment | 0 complexity | 3ffc83920d9ad9e3111368162d45a18a MD5 | raw file
  1>Sequence_92 %GC 50.0 Score 9 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
  2aattgaaagcggttggcctagag
  3>Sequence_53 %GC 45.0 Score 8 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
  4aatggctttacaccgactagaaa
  5>Sequence_97 %GC 55.0 Score 8 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
  6aaagcggttggcctagagtgtta
  7>Sequence_98 %GC 55.0 Score 8 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
  8aagcggttggcctagagtgttac
  9>Sequence_201 %GC 55.0 Score 8 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 10aacaagtacgagtctctcccccc
 11>Sequence_14 %GC 40.0 Score 7 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 12aataccttcttttgtccctacac
 13>Sequence_85 %GC 40.0 Score 7 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 14aagcactaattgaaagcggttgg
 15>Sequence_181 %GC 40.0 Score 7 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 16aagacgttgtggaagaatacaac
 17>Sequence_196 %GC 40.0 Score 7 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 18aatacaacaagtacgagtctctc
 19>Sequence_204 %GC 60.0 Score 7 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 20aagtacgagtctctcccccctgg
 21>Sequence_252 %GC 60.0 Score 7 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 22aatacccttcgcaacaccgcgta
 23>Sequence_264 %GC 40.0 Score 7 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 24aacaccgcgtaactatctatatg
 25>Sequence_38 %GC 45.0 Score 6 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 26gaccacagttttcctaatggctt
 27>Sequence_73 %GC 35.0 Score 6 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 28aaattcttgtgcaagcactaatt
 29>Sequence_96 %GC 55.0 Score 6 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 30gaaagcggttggcctagagtgtt
 31>Sequence_118 %GC 50.0 Score 6 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 32taccggtttgtatagctgagcgc
 33>Sequence_200 %GC 50.0 Score 6 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 34caacaagtacgagtctctccccc
 35>Sequence_326 %GC 35.0 Score 6 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 36aatcttcctttagcaagtctttt
 37>Sequence_364 %GC 35.0 Score 6 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 38aatgttcatgttcttaggttgtt
 39>Sequence_12 %GC 35.0 Score 5 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 40aaaataccttcttttgtccctac
 41>Sequence_13 %GC 35.0 Score 5 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 42aaataccttcttttgtccctaca
 43>Sequence_16 %GC 45.0 Score 5 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 44taccttcttttgtccctacacag
 45>Sequence_32 %GC 45.0 Score 5 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 46tacacagaccacagttttcctaa
 47>Sequence_52 %GC 45.0 Score 5 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 48taatggctttacaccgactagaa
 49>Sequence_74 %GC 35.0 Score 5 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 50aattcttgtgcaagcactaattg
 51>Sequence_88 %GC 45.0 Score 5 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 52cactaattgaaagcggttggcct
 53>Sequence_91 %GC 45.0 Score 5 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 54taattgaaagcggttggcctaga
 55>Sequence_128 %GC 55.0 Score 5 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 56tatagctgagcgcgtctcttgcc
 57>Sequence_173 %GC 45.0 Score 5 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 58tactttggaagacgttgtggaag
 59>Sequence_193 %GC 35.0 Score 5 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 60aagaatacaacaagtacgagtct
 61>Sequence_198 %GC 45.0 Score 5 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 62tacaacaagtacgagtctctccc
 63>Sequence_243 %GC 45.0 Score 5 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 64tacagttgtaatacccttcgcaa
 65>Sequence_251 %GC 55.0 Score 5 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 66taatacccttcgcaacaccgcgt
 67>Sequence_313 %GC 40.0 Score 5 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 68taggttcgtctttaatcttcctt
 69>Sequence_340 %GC 35.0 Score 5 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 70aagtcttttactgttttcgacct
 71>Sequence_393 %GC 35.0 Score 5 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 72aatatgcggtcagtttaatcttc
 73>Sequence_489 %GC 40.0 Score 5 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 74tactctgtttgtatacagcagtt
 75>Sequence_34 %GC 40.0 Score 4 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 76cacagaccacagttttcctaatg
 77>Sequence_36 %GC 40.0 Score 4 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 78cagaccacagttttcctaatggc
 79>Sequence_61 %GC 40.0 Score 4 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 80tacaccgactagaaattcttgtg
 81>Sequence_63 %GC 40.0 Score 4 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 82caccgactagaaattcttgtgca
 83>Sequence_70 %GC 40.0 Score 4 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 84tagaaattcttgtgcaagcacta
 85>Sequence_84 %GC 40.0 Score 4 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 86caagcactaattgaaagcggttg
 87>Sequence_110 %GC 40.0 Score 4 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 88tagagtgttaccggtttgtatag
 89>Sequence_112 %GC 40.0 Score 4 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 90gagtgttaccggtttgtatagct
 91>Sequence_135 %GC 60.0 Score 4 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 92gagcgcgtctcttgccctgatca
 93>Sequence_180 %GC 40.0 Score 4 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 94gaagacgttgtggaagaatacaa
 95>Sequence_183 %GC 40.0 Score 4 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 96gacgttgtggaagaatacaacaa
 97>Sequence_203 %GC 60.0 Score 4 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 98caagtacgagtctctcccccctg
 99>Sequence_210 %GC 60.0 Score 4 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
100gagtctctcccccctggtttgct
101>Sequence_245 %GC 40.0 Score 4 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
102cagttgtaatacccttcgcaaca
103>Sequence_254 %GC 60.0 Score 4 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
104tacccttcgcaacaccgcgtaac
105>Sequence_263 %GC 40.0 Score 4 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
106caacaccgcgtaactatctatat
107>Sequence_266 %GC 40.0 Score 4 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
108caccgcgtaactatctatatgaa
109>Sequence_348 %GC 40.0 Score 4 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
110tactgttttcgacctcaatgttc
111>Sequence_395 %GC 40.0 Score 4 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
112tatgcggtcagtttaatcttcgt
113>Sequence_157 %GC 30.0 Score 3 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
114aaaggttcattttctctactttg
115>Sequence_158 %GC 30.0 Score 3 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
116aaggttcattttctctactttgg
117>Sequence_207 %GC 65.0 Score 3 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
118tacgagtctctcccccctggttt
119>Sequence_325 %GC 35.0 Score 3 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
120taatcttcctttagcaagtcttt
121>Sequence_392 %GC 35.0 Score 3 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
122taatatgcggtcagtttaatctt
123>Sequence_409 %GC 30.0 Score 3 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
124aatcttcgttgtttcttcttaaa
125>Sequence_11 %GC 35.0 Score 2 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
126taaaataccttcttttgtcccta
127>Sequence_41 %GC 35.0 Score 2 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
128cacagttttcctaatggctttac
129>Sequence_43 %GC 35.0 Score 2 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
130cagttttcctaatggctttacac
131>Sequence_67 %GC 35.0 Score 2 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
132gactagaaattcttgtgcaagca
133>Sequence_72 %GC 35.0 Score 2 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
134gaaattcttgtgcaagcactaat
135>Sequence_130 %GC 65.0 Score 2 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
136tagctgagcgcgtctcttgccct
137>Sequence_192 %GC 35.0 Score 2 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
138gaagaatacaacaagtacgagtc
139>Sequence_195 %GC 35.0 Score 2 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
140gaatacaacaagtacgagtctct
141>Sequence_236 %GC 35.0 Score 2 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
142tactggatacagttgtaataccc
143>Sequence_241 %GC 35.0 Score 2 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
144gatacagttgtaatacccttcgc
145>Sequence_304 %GC 35.0 Score 2 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
146tatatgtagtaggttcgtcttta
147>Sequence_306 %GC 35.0 Score 2 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
148tatgtagtaggttcgtctttaat
149>Sequence_310 %GC 35.0 Score 2 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
150tagtaggttcgtctttaatcttc
151>Sequence_358 %GC 35.0 Score 2 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
152gacctcaatgttcatgttcttag
153>Sequence_370 %GC 35.0 Score 2 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
154catgttcttaggttgttttggat
155>Sequence_156 %GC 30.0 Score 1 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
156caaaggttcattttctctacttt
157>Sequence_403 %GC 30.0 Score 1 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
158cagtttaatcttcgttgtttctt