PageRenderTime 20ms CodeModel.GetById 16ms app.highlight 1ms RepoModel.GetById 1ms app.codeStats 0ms

/test-data/fasta_nuc_changer2.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 50 lines | 50 code | 0 blank | 0 comment | 0 complexity | b13ad28478a718c66456d292c08c2dd5 MD5 | raw file
 1>cel-let-7 MIMAT0000001 Caenorhabditis elegans let-7
 2UGAGGUAGUAGGUUGUAUAGUU
 3>cel-lin-4 MIMAT0000002 Caenorhabditis elegans lin-4
 4UCCCUGAGACCUCAAGUGUGA
 5>cel-miR-1 MIMAT0000003 Caenorhabditis elegans miR-1
 6UGGAAUGUAAAGAAGUAUGUA
 7>cel-miR-2 MIMAT0000004 Caenorhabditis elegans miR-2
 8UAUCACAGCCAGCUUUGAUGUGC
 9>cel-miR-34 MIMAT0000005 Caenorhabditis elegans miR-34
10AGGCAGUGUGGUUAGCUGGUUG
11>cel-miR-35 MIMAT0000006 Caenorhabditis elegans miR-35
12UCACCGGGUGGAAACUAGCAGU
13>cel-miR-36 MIMAT0000007 Caenorhabditis elegans miR-36
14UCACCGGGUGAAAAUUCGCAUG
15>cel-miR-37 MIMAT0000008 Caenorhabditis elegans miR-37
16UCACCGGGUGAACACUUGCAGU
17>cel-miR-38 MIMAT0000009 Caenorhabditis elegans miR-38
18UCACCGGGAGAAAAACUGGAGU
19>cel-miR-39 MIMAT0000010 Caenorhabditis elegans miR-39
20UCACCGGGUGUAAAUCAGCUUG
21>cel-miR-40 MIMAT0000011 Caenorhabditis elegans miR-40
22UCACCGGGUGUACAUCAGCUAA
23>cel-miR-41 MIMAT0000012 Caenorhabditis elegans miR-41
24UCACCGGGUGAAAAAUCACCUA
25>cel-miR-42 MIMAT0000013 Caenorhabditis elegans miR-42
26UCACCGGGUUAACAUCUACAGA
27>cel-miR-43 MIMAT0000014 Caenorhabditis elegans miR-43
28UAUCACAGUUUACUUGCUGUCGC
29>cel-miR-44 MIMAT0000015 Caenorhabditis elegans miR-44
30UGACUAGAGACACAUUCAGCU
31>cel-miR-45 MIMAT0000016 Caenorhabditis elegans miR-45
32UGACUAGAGACACAUUCAGCU
33>cel-miR-46 MIMAT0000017 Caenorhabditis elegans miR-46
34UGUCAUGGAGUCGCUCUCUUCA
35>cel-miR-47 MIMAT0000018 Caenorhabditis elegans miR-47
36UGUCAUGGAGGCGCUCUCUUCA
37>cel-miR-48 MIMAT0000019 Caenorhabditis elegans miR-48
38UGAGGUAGGCUCAGUAGAUGCGA
39>cel-miR-49 MIMAT0000020 Caenorhabditis elegans miR-49
40AAGCACCACGAGAAGCUGCAGA
41>cel-miR-50 MIMAT0000021 Caenorhabditis elegans miR-50
42UGAUAUGUCUGGUAUUCUUGGG
43>cel-miR-51 MIMAT0000022 Caenorhabditis elegans miR-51
44UACCCGUAGCUCCUAUCCAUGUU
45>cel-miR-52 MIMAT0000023 Caenorhabditis elegans miR-52
46CACCCGUACAUAUGUUUCCGUGCU
47>cel-miR-53 MIMAT0000024 Caenorhabditis elegans miR-53
48CACCCGUACAUUUGUUUCCGUGCU
49>cel-miR-54 MIMAT0000025 Caenorhabditis elegans miR-54
50UACCCGUAAUCUUCAUAAUCCGAG