/test-data/misc_rna_as_sanger_rev_comp_1.fastqsanger
https://bitbucket.org/cistrome/cistrome-harvard/ · Unknown · 16 lines · 16 code · 0 blank · 0 comment · 0 complexity · b5b52c07de8efc1d69f4e95618d6a342 MD5 · raw file
- @FAKE0011 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order)
- UACGUACGUACGUACGUACGUACGUACGUACGUACGUACGU
- +
- IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
- @FAKE0012 Original version has mixed case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order)
- cgCUaugAcgCUaugAcgCUaugAcgCUaugAcgCUaugAc
- +
- IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
- @FAKE0013 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order)
- acugacugacugacugacugacugacugacugacugacuga
- +
- IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
- @FAKE0014 Original version has mixed case ambiguous RNA with PHRED scores from 35 to 40 inclusive (cycled)
- NHBVDMKSWRYGAUCnhbvdmkswrygauc
- +
- IHGFEDIHGFEDIHGFEDIHGFEDIHGFED