PageRenderTime 75ms CodeModel.GetById 70ms app.highlight 2ms RepoModel.GetById 1ms app.codeStats 0ms

/test-data/misc_rna_as_sanger_rev_comp_1.fastqsanger

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 16 lines | 16 code | 0 blank | 0 comment | 0 complexity | b5b52c07de8efc1d69f4e95618d6a342 MD5 | raw file
 1@FAKE0011 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order)
 2UACGUACGUACGUACGUACGUACGUACGUACGUACGUACGU
 3+
 4IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
 5@FAKE0012 Original version has mixed case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order)
 6cgCUaugAcgCUaugAcgCUaugAcgCUaugAcgCUaugAc
 7+
 8IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
 9@FAKE0013 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order)
10acugacugacugacugacugacugacugacugacugacuga
11+
12IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
13@FAKE0014 Original version has mixed case ambiguous RNA with PHRED scores from 35 to 40 inclusive (cycled)
14NHBVDMKSWRYGAUCnhbvdmkswrygauc
15+
16IHGFEDIHGFEDIHGFEDIHGFEDIHGFED