PageRenderTime 14ms CodeModel.GetById 11ms app.highlight 0ms RepoModel.GetById 2ms app.codeStats 0ms

/test-data/emboss_union_out.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 11 lines | 11 code | 0 blank | 0 comment | 0 complexity | 609ac59b9ed59f7bde4cb160c57ad160 MD5 | raw file
 1>Sequence 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
 2gttcgatgcctaaaataccttcttttgtccctacacagaccacagttttcctaatggctt
 3tacaccgactagaaattcttgtgcaagcactaattgaaagcggttggcctagagtgttac
 4cggtttgtatagctgagcgcgtctcttgccctgatcaaaggttcattttctctactttgg
 5aagacgttgtggaagaatacaacaagtacgagtctctcccccctggtttgctgattactg
 6gatacagttgtaatacccttcgcaacaccgcgtaactatctatatgaattattttccctt
 7tattatatgtagtaggttcgtctttaatcttcctttagcaagtcttttactgttttcgac
 8ctcaatgttcatgttcttaggttgttttggataatatgcggtcagtttaatcttcgttgt
 9ttcttcttaaaatatttattcatggtttaatttttggtttgtacttgttcaggggccagt
10tcattatttactctgtttgtatacagcagttcttttatttttagtatgattttaatttaa
11aacaattctaatggtcaaaaa