PageRenderTime 64ms CodeModel.GetById 14ms app.highlight 42ms RepoModel.GetById 1ms app.codeStats 0ms

/test-data/fastqc_report.html

https://bitbucket.org/cistrome/cistrome-harvard/
HTML | 1809 lines | 1780 code | 29 blank | 0 comment | 0 complexity | 90c16e73f919ce873f92d7924781beeb MD5 | raw file
   1<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Strict//EN">
   2<html>
   3<head><title>dataset_1.dat FastQC Report</title>
   4
   5<style type="text/css">
   6
   7 @media screen {
   8  div.summary {
   9    width: 18em;
  10    position:fixed;
  11    top: 3em;
  12    margin:1em 0 0 1em;
  13  }
  14  
  15  div.main {
  16    display:block;
  17    position:absolute;
  18    overflow:auto;
  19    height:auto;
  20    width:auto;
  21    top:4.5em;
  22    bottom:2.3em;
  23    left:18em;
  24    right:0;
  25    border-left: 1px solid #CCC;
  26    padding:0 0 0 1em;
  27    background-color: white;
  28    z-index:1;
  29  }
  30  
  31  div.header {
  32    background-color: #EEE;
  33    border:0;
  34    margin:0;
  35    padding: 0.5em;
  36    font-size: 200%;
  37    font-weight: bold;
  38    position:fixed;
  39    width:100%;
  40    top:0;
  41    left:0;
  42    z-index:2;
  43  }
  44
  45  div.footer {
  46    background-color: #EEE;
  47    border:0;
  48    margin:0;
  49	padding:0.5em;
  50    height: 1.3em;
  51	overflow:hidden;
  52    font-size: 100%;
  53    font-weight: bold;
  54    position:fixed;
  55    bottom:0;
  56    width:100%;
  57    z-index:2;
  58  }
  59  
  60  img.indented {
  61    margin-left: 3em;
  62  }
  63 }
  64 
  65 @media print {
  66	img {
  67		max-width:100% !important;
  68		page-break-inside: avoid;
  69	}
  70	h2, h3 {
  71		page-break-after: avoid;
  72	}
  73	div.header {
  74      background-color: #FFF;
  75    }
  76	
  77 }
  78 
  79 body {    
  80  font-family: sans-serif;   
  81  color: #000;   
  82  background-color: #FFF;
  83  border: 0;
  84  margin: 0;
  85  padding: 0;
  86  }
  87  
  88  div.header {
  89  border:0;
  90  margin:0;
  91  padding: 0.5em;
  92  font-size: 200%;
  93  font-weight: bold;
  94  width:100%;
  95  }    
  96  
  97  #header_title {
  98  display:inline-block;
  99  float:left;
 100  clear:left;
 101  }
 102  #header_filename {
 103  display:inline-block;
 104  float:right;
 105  clear:right;
 106  font-size: 50%;
 107  margin-right:2em;
 108  text-align: right;
 109  }
 110
 111  div.header h3 {
 112  font-size: 50%;
 113  margin-bottom: 0;
 114  }
 115  
 116  div.summary ul {
 117  padding-left:0;
 118  list-style-type:none;
 119  }
 120  
 121  div.summary ul li img {
 122  margin-bottom:-0.5em;
 123  margin-top:0.5em;
 124  }
 125	  
 126  div.main {
 127  background-color: white;
 128  }
 129      
 130  div.module {
 131  padding-bottom:1.5em;
 132  padding-top:1.5em;
 133  }
 134	  
 135  div.footer {
 136  background-color: #EEE;
 137  border:0;
 138  margin:0;
 139  padding: 0.5em;
 140  font-size: 100%;
 141  font-weight: bold;
 142  width:100%;
 143  }
 144
 145
 146  a {
 147  color: #000080;
 148  }
 149
 150  a:hover {
 151  color: #800000;
 152  }
 153      
 154  h2 {
 155  color: #800000;
 156  padding-bottom: 0;
 157  margin-bottom: 0;
 158  clear:left;
 159  }
 160
 161  table { 
 162  margin-left: 3em;
 163  text-align: center;
 164  }
 165  
 166  th { 
 167  text-align: center;
 168  background-color: #000080;
 169  color: #FFF;
 170  padding: 0.4em;
 171  }      
 172  
 173  td { 
 174  font-family: monospace; 
 175  text-align: left;
 176  background-color: #EEE;
 177  color: #000;
 178  padding: 0.4em;
 179  }
 180
 181  img {
 182  padding-top: 0;
 183  margin-top: 0;
 184  border-top: 0;
 185  }
 186
 187  
 188  p {
 189  padding-top: 0;
 190  margin-top: 0;
 191  }
 192  
 193</style>
 194
 195</head>
 196<body>
 197<div class="header">
 198<div id="header_title"><img src="fastqc_icon.png" alt="FastQC">FastQC Report</div>
 199<div id="header_filename">
 200Wed 16 Nov 2011<br />
 201dataset_1.dat
 202</div>
 203</div>
 204<div class="summary">
 205<h2>Summary</h2>
 206<ul>
 207<li><img src="tick.png" alt="[PASS]"> <a href="#M0">Basic Statistics</a></li>
 208<li><img src="warning.png" alt="[WARNING]"> <a href="#M1">Per base sequence quality</a></li>
 209<li><img src="warning.png" alt="[WARNING]"> <a href="#M2">Per sequence quality scores</a></li>
 210<li><img src="warning.png" alt="[WARNING]"> <a href="#M3">Per base sequence content</a></li>
 211<li><img src="tick.png" alt="[PASS]"> <a href="#M4">Per base GC content</a></li>
 212<li><img src="warning.png" alt="[WARNING]"> <a href="#M5">Per sequence GC content</a></li>
 213<li><img src="tick.png" alt="[PASS]"> <a href="#M6">Per base N content</a></li>
 214<li><img src="tick.png" alt="[PASS]"> <a href="#M7">Sequence Length Distribution</a></li>
 215<li><img src="tick.png" alt="[PASS]"> <a href="#M8">Sequence Duplication Levels</a></li>
 216<li><img src="warning.png" alt="[WARNING]"> <a href="#M9">Overrepresented sequences</a></li>
 217<li><img src="error.png" alt="[FAIL]"> <a href="#M10">Kmer Content</a></li>
 218</ul>
 219</div>
 220<div class="main">
 221<div class="module"><h2 id="M0"><img src="tick.png" alt="[OK]"> Basic Statistics</h2>
 222<table>
 223<tr>
 224<th>Measure</th>
 225<th>Value</th>
 226</tr>
 227<tr>
 228<td>Filename</td>
 229<td>dataset_1.dat</td>
 230</tr>
 231<tr>
 232<td>File type</td>
 233<td>Conventional base calls</td>
 234</tr>
 235<tr>
 236<td>Encoding</td>
 237<td>Sanger / Illumina 1.9</td>
 238</tr>
 239<tr>
 240<td>Total Sequences</td>
 241<td>5000</td>
 242</tr>
 243<tr>
 244<td>Filtered Sequences</td>
 245<td>0</td>
 246</tr>
 247<tr>
 248<td>Sequence length</td>
 249<td>54</td>
 250</tr>
 251<tr>
 252<td>%GC</td>
 253<td>43</td>
 254</tr>
 255</table>
 256</div>
 257<div class="module"><h2 id="M1"><img src="warning.png" alt="[WARN]"> Per base sequence quality</h2>
 258<p><img class="indented" src="per_base_quality.png" alt="Per base quality graph"></p>
 259</div>
 260<div class="module"><h2 id="M2"><img src="warning.png" alt="[WARN]"> Per sequence quality scores</h2>
 261<p><img class="indented" src="per_sequence_quality.png" alt="Per Sequence quality graph"></p>
 262</div>
 263<div class="module"><h2 id="M3"><img src="warning.png" alt="[WARN]"> Per base sequence content</h2>
 264<p><img class="indented" src="per_base_sequence_content.png" alt="Per base sequence content"></p>
 265</div>
 266<div class="module"><h2 id="M4"><img src="tick.png" alt="[OK]"> Per base GC content</h2>
 267<p><img class="indented" src="per_base_gc_content.png" alt="Per base GC content graph"></p>
 268</div>
 269<div class="module"><h2 id="M5"><img src="warning.png" alt="[WARN]"> Per sequence GC content</h2>
 270<p><img class="indented" src="per_sequence_gc_content.png" alt="Per sequence GC content graph"></p>
 271</div>
 272<div class="module"><h2 id="M6"><img src="tick.png" alt="[OK]"> Per base N content</h2>
 273<p><img class="indented" src="per_base_n_content.png" alt="N content graph"></p>
 274</div>
 275<div class="module"><h2 id="M7"><img src="tick.png" alt="[OK]"> Sequence Length Distribution</h2>
 276<p><img class="indented" src="sequence_length_distribution.png" alt="Sequence length distribution"></p>
 277</div>
 278<div class="module"><h2 id="M8"><img src="tick.png" alt="[OK]"> Sequence Duplication Levels</h2>
 279<p><img class="indented" src="duplication_levels.png" alt="Duplication level graph"></p>
 280</div>
 281<div class="module"><h2 id="M9"><img src="warning.png" alt="[WARN]"> Overrepresented sequences</h2>
 282<table>
 283<tr>
 284<th>Sequence</th>
 285<th>Count</th>
 286<th>Percentage</th>
 287<th>Possible Source</th>
 288</tr>
 289<tr>
 290<td>CGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAAT</td>
 291<td>7</td>
 292<td>0.13999999999999999</td>
 293<td>Illumina Paired End PCR Primer 2 (96% over 33bp)</td>
 294</tr>
 295<tr>
 296<td>CGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGAC</td>
 297<td>7</td>
 298<td>0.13999999999999999</td>
 299<td>Illumina Paired End PCR Primer 2 (100% over 35bp)</td>
 300</tr>
 301</table>
 302</div>
 303<div class="module"><h2 id="M10"><img src="error.png" alt="[FAIL]"> Kmer Content</h2>
 304<p><img class="indented" src="kmer_profiles.png" alt="Kmer graph"></p>
 305<table>
 306<tr>
 307<th>Sequence</th>
 308<th>Count</th>
 309<th>Obs/Exp Overall</th>
 310<th>Obs/Exp Max</th>
 311<th>Max Obs/Exp Position</th>
 312</tr>
 313<tr>
 314<td>CCCCC</td>
 315<td>1180</td>
 316<td>9.957459</td>
 317<td>29.638031</td>
 318<td>50</td>
 319</tr>
 320<tr>
 321<td>AAAAA</td>
 322<td>2175</td>
 323<td>4.133217</td>
 324<td>7.129659</td>
 325<td>47</td>
 326</tr>
 327<tr>
 328<td>CTCCC</td>
 329<td>555</td>
 330<td>3.668942</td>
 331<td>11.56272</td>
 332<td>11</td>
 333</tr>
 334<tr>
 335<td>CCTCC</td>
 336<td>525</td>
 337<td>3.4706206</td>
 338<td>11.56272</td>
 339<td>14</td>
 340</tr>
 341<tr>
 342<td>CTGGG</td>
 343<td>465</td>
 344<td>3.0945942</td>
 345<td>8.331139</td>
 346<td>39</td>
 347</tr>
 348<tr>
 349<td>GGGGG</td>
 350<td>350</td>
 351<td>2.9865708</td>
 352<td>12.818572</td>
 353<td>41</td>
 354</tr>
 355<tr>
 356<td>TGGAA</td>
 357<td>800</td>
 358<td>2.9261596</td>
 359<td>6.397646</td>
 360<td>17</td>
 361</tr>
 362<tr>
 363<td>CCCAG</td>
 364<td>455</td>
 365<td>2.855999</td>
 366<td>9.429343</td>
 367<td>40</td>
 368</tr>
 369<tr>
 370<td>GAATG</td>
 371<td>775</td>
 372<td>2.8347175</td>
 373<td>10.053445</td>
 374<td>20</td>
 375</tr>
 376<tr>
 377<td>GTGTG</td>
 378<td>530</td>
 379<td>2.763172</td>
 380<td>7.8240557</td>
 381<td>33</td>
 382</tr>
 383<tr>
 384<td>GGGAG</td>
 385<td>435</td>
 386<td>2.7487729</td>
 387<td>6.3220544</td>
 388<td>43</td>
 389</tr>
 390<tr>
 391<td>TGTGT</td>
 392<td>670</td>
 393<td>2.7303638</td>
 394<td>6.109576</td>
 395<td>27</td>
 396</tr>
 397<tr>
 398<td>ATGGA</td>
 399<td>735</td>
 400<td>2.688409</td>
 401<td>6.397646</td>
 402<td>20</td>
 403</tr>
 404<tr>
 405<td>GGAAT</td>
 406<td>730</td>
 407<td>2.6701207</td>
 408<td>7.3115954</td>
 409<td>19</td>
 410</tr>
 411<tr>
 412<td>GCTGG</td>
 413<td>400</td>
 414<td>2.6620166</td>
 415<td>8.322799</td>
 416<td>31</td>
 417</tr>
 418<tr>
 419<td>GGAGG</td>
 420<td>420</td>
 421<td>2.6539874</td>
 422<td>7.9104857</td>
 423<td>40</td>
 424</tr>
 425<tr>
 426<td>GCAGG</td>
 427<td>405</td>
 428<td>2.5535064</td>
 429<td>14.17877</td>
 430<td>16</td>
 431</tr>
 432<tr>
 433<td>CCTGG</td>
 434<td>375</td>
 435<td>2.4900866</td>
 436<td>6.6367774</td>
 437<td>7</td>
 438</tr>
 439<tr>
 440<td>CAGCC</td>
 441<td>390</td>
 442<td>2.4479992</td>
 443<td>6.279937</td>
 444<td>38</td>
 445</tr>
 446<tr>
 447<td>GGCTG</td>
 448<td>365</td>
 449<td>2.4290898</td>
 450<td>9.97737</td>
 451<td>24</td>
 452</tr>
 453<tr>
 454<td>TGGGA</td>
 455<td>490</td>
 456<td>2.4202447</td>
 457<td>7.40506</td>
 458<td>20</td>
 459</tr>
 460<tr>
 461<td>CCAGC</td>
 462<td>385</td>
 463<td>2.4166145</td>
 464<td>6.286229</td>
 465<td>41</td>
 466</tr>
 467<tr>
 468<td>AATGG</td>
 469<td>660</td>
 470<td>2.4140818</td>
 471<td>5.4836965</td>
 472<td>18</td>
 473</tr>
 474<tr>
 475<td>GCCTG</td>
 476<td>360</td>
 477<td>2.3904827</td>
 478<td>8.295971</td>
 479<td>5</td>
 480</tr>
 481<tr>
 482<td>GCCTC</td>
 483<td>360</td>
 484<td>2.3851626</td>
 485<td>6.6286345</td>
 486<td>31</td>
 487</tr>
 488<tr>
 489<td>CCCTC</td>
 490<td>360</td>
 491<td>2.379854</td>
 492<td>8.267352</td>
 493<td>34</td>
 494</tr>
 495<tr>
 496<td>CTGTG</td>
 497<td>450</td>
 498<td>2.3408678</td>
 499<td>9.09864</td>
 500<td>44</td>
 501</tr>
 502<tr>
 503<td>GGAAG</td>
 504<td>500</td>
 505<td>2.3397229</td>
 506<td>14.031037</td>
 507<td>2</td>
 508</tr>
 509<tr>
 510<td>CAGCA</td>
 511<td>500</td>
 512<td>2.32932</td>
 513<td>10.47649</td>
 514<td>14</td>
 515</tr>
 516<tr>
 517<td>CAGGA</td>
 518<td>495</td>
 519<td>2.3111706</td>
 520<td>13.99981</td>
 521<td>17</td>
 522</tr>
 523<tr>
 524<td>TCCCA</td>
 525<td>470</td>
 526<td>2.305994</td>
 527<td>7.370469</td>
 528<td>39</td>
 529</tr>
 530<tr>
 531<td>CTGCC</td>
 532<td>345</td>
 533<td>2.285781</td>
 534<td>8.277508</td>
 535<td>10</td>
 536</tr>
 537<tr>
 538<td>GGTGG</td>
 539<td>340</td>
 540<td>2.2677608</td>
 541<td>5.009832</td>
 542<td>42</td>
 543</tr>
 544<tr>
 545<td>CCAGG</td>
 546<td>360</td>
 547<td>2.264732</td>
 548<td>6.300251</td>
 549<td>41</td>
 550</tr>
 551<tr>
 552<td>TTCCT</td>
 553<td>555</td>
 554<td>2.2516627</td>
 555<td>7.0961456</td>
 556<td>1</td>
 557</tr>
 558<tr>
 559<td>TCCCC</td>
 560<td>335</td>
 561<td>2.2145865</td>
 562<td>8.267353</td>
 563<td>29</td>
 564</tr>
 565<tr>
 566<td>CAGGC</td>
 567<td>350</td>
 568<td>2.2018228</td>
 569<td>6.300251</td>
 570<td>42</td>
 571</tr>
 572<tr>
 573<td>CTCCT</td>
 574<td>425</td>
 575<td>2.2009897</td>
 576<td>6.4701333</td>
 577<td>15</td>
 578</tr>
 579<tr>
 580<td>GGCAG</td>
 581<td>340</td>
 582<td>2.1436844</td>
 583<td>6.301676</td>
 584<td>16</td>
 585</tr>
 586<tr>
 587<td>CCCCA</td>
 588<td>340</td>
 589<td>2.129403</td>
 590<td>6.26596</td>
 591<td>31</td>
 592</tr>
 593<tr>
 594<td>CTCTG</td>
 595<td>410</td>
 596<td>2.1280441</td>
 597<td>5.1928453</td>
 598<td>48</td>
 599</tr>
 600<tr>
 601<td>TGGTG</td>
 602<td>405</td>
 603<td>2.1114805</td>
 604<td>6.520046</td>
 605<td>33</td>
 606</tr>
 607<tr>
 608<td>TTCCA</td>
 609<td>545</td>
 610<td>2.094778</td>
 611<td>6.7295837</td>
 612<td>33</td>
 613</tr>
 614<tr>
 615<td>CCCCT</td>
 616<td>315</td>
 617<td>2.0823722</td>
 618<td>6.607268</td>
 619<td>12</td>
 620</tr>
 621<tr>
 622<td>CTCAG</td>
 623<td>420</td>
 624<td>2.0652719</td>
 625<td>6.149596</td>
 626<td>46</td>
 627</tr>
 628<tr>
 629<td>AGGGA</td>
 630<td>440</td>
 631<td>2.0589561</td>
 632<td>7.0225415</td>
 633<td>31</td>
 634</tr>
 635<tr>
 636<td>CAGAG</td>
 637<td>440</td>
 638<td>2.054374</td>
 639<td>5.8390937</td>
 640<td>38</td>
 641</tr>
 642<tr>
 643<td>AGCAG</td>
 644<td>440</td>
 645<td>2.0543735</td>
 646<td>10.499857</td>
 647<td>15</td>
 648</tr>
 649<tr>
 650<td>CCCTG</td>
 651<td>310</td>
 652<td>2.05389</td>
 653<td>6.622006</td>
 654<td>24</td>
 655</tr>
 656<tr>
 657<td>CTTCC</td>
 658<td>390</td>
 659<td>2.0197318</td>
 660<td>6.4701333</td>
 661<td>17</td>
 662</tr>
 663<tr>
 664<td>AGGAA</td>
 665<td>580</td>
 666<td>2.0098667</td>
 667<td>10.390455</td>
 668<td>18</td>
 669</tr>
 670<tr>
 671<td>AGAGC</td>
 672<td>430</td>
 673<td>2.0076835</td>
 674<td>10.499858</td>
 675<td>5</td>
 676</tr>
 677<tr>
 678<td>TCTCC</td>
 679<td>385</td>
 680<td>1.9938378</td>
 681<td>5.181288</td>
 682<td>29</td>
 683</tr>
 684<tr>
 685<td>TCCTC</td>
 686<td>385</td>
 687<td>1.9938378</td>
 688<td>5.181288</td>
 689<td>48</td>
 690</tr>
 691<tr>
 692<td>TCAGC</td>
 693<td>405</td>
 694<td>1.9915122</td>
 695<td>12.286894</td>
 696<td>44</td>
 697</tr>
 698<tr>
 699<td>TGCTG</td>
 700<td>380</td>
 701<td>1.9767327</td>
 702<td>6.5055346</td>
 703<td>47</td>
 704</tr>
 705<tr>
 706<td>CACCC</td>
 707<td>315</td>
 708<td>1.9728295</td>
 709<td>6.259694</td>
 710<td>9</td>
 711</tr>
 712<tr>
 713<td>TCCTG</td>
 714<td>380</td>
 715<td>1.9723336</td>
 716<td>6.4845653</td>
 717<td>8</td>
 718</tr>
 719<tr>
 720<td>CAGGG</td>
 721<td>310</td>
 722<td>1.954536</td>
 723<td>6.3016763</td>
 724<td>21</td>
 725</tr>
 726<tr>
 727<td>GATGG</td>
 728<td>395</td>
 729<td>1.9510134</td>
 730<td>6.1708827</td>
 731<td>1</td>
 732</tr>
 733<tr>
 734<td>TGGCT</td>
 735<td>375</td>
 736<td>1.9507233</td>
 737<td>9.098641</td>
 738<td>45</td>
 739</tr>
 740<tr>
 741<td>AAGAG</td>
 742<td>560</td>
 743<td>1.9405607</td>
 744<td>9.524584</td>
 745<td>4</td>
 746</tr>
 747<tr>
 748<td>TGTGG</td>
 749<td>370</td>
 750<td>1.929007</td>
 751<td>6.5200467</td>
 752<td>30</td>
 753</tr>
 754<tr>
 755<td>CTGAG</td>
 756<td>390</td>
 757<td>1.9220302</td>
 758<td>6.163313</td>
 759<td>35</td>
 760</tr>
 761<tr>
 762<td>CCTGT</td>
 763<td>370</td>
 764<td>1.9204301</td>
 765<td>6.4845653</td>
 766<td>6</td>
 767</tr>
 768<tr>
 769<td>CAGAA</td>
 770<td>555</td>
 771<td>1.9189543</td>
 772<td>6.0476103</td>
 773<td>6</td>
 774</tr>
 775<tr>
 776<td>TCCCT</td>
 777<td>370</td>
 778<td>1.9161558</td>
 779<td>6.4766097</td>
 780<td>33</td>
 781</tr>
 782<tr>
 783<td>CCCAC</td>
 784<td>305</td>
 785<td>1.9101999</td>
 786<td>6.259694</td>
 787<td>4</td>
 788</tr>
 789<tr>
 790<td>CACCA</td>
 791<td>405</td>
 792<td>1.8825499</td>
 793<td>6.9757566</td>
 794<td>33</td>
 795</tr>
 796<tr>
 797<td>AAAGA</td>
 798<td>730</td>
 799<td>1.8732982</td>
 800<td>5.1399345</td>
 801<td>42</td>
 802</tr>
 803<tr>
 804<td>CAGTG</td>
 805<td>380</td>
 806<td>1.8727474</td>
 807<td>6.163313</td>
 808<td>30</td>
 809</tr>
 810<tr>
 811<td>GAAGA</td>
 812<td>540</td>
 813<td>1.8712552</td>
 814<td>7.792842</td>
 815<td>26</td>
 816</tr>
 817<tr>
 818<td>TCTCT</td>
 819<td>460</td>
 820<td>1.8662432</td>
 821<td>5.068676</td>
 822<td>8</td>
 823</tr>
 824<tr>
 825<td>TTTCC</td>
 826<td>460</td>
 827<td>1.8662429</td>
 828<td>5.073749</td>
 829<td>38</td>
 830</tr>
 831<tr>
 832<td>GAGGC</td>
 833<td>295</td>
 834<td>1.8599615</td>
 835<td>6.301676</td>
 836<td>22</td>
 837</tr>
 838<tr>
 839<td>TCTGT</td>
 840<td>455</td>
 841<td>1.8500755</td>
 842<td>5.0850673</td>
 843<td>49</td>
 844</tr>
 845<tr>
 846<td>CCTGC</td>
 847<td>275</td>
 848<td>1.8219992</td>
 849<td>9.93301</td>
 850<td>6</td>
 851</tr>
 852<tr>
 853<td>CCTCT</td>
 854<td>350</td>
 855<td>1.8125799</td>
 856<td>7.7641597</td>
 857<td>2</td>
 858</tr>
 859<tr>
 860<td>TGCCT</td>
 861<td>345</td>
 862<td>1.7906713</td>
 863<td>5.187652</td>
 864<td>12</td>
 865</tr>
 866<tr>
 867<td>TTCCC</td>
 868<td>345</td>
 869<td>1.7866857</td>
 870<td>6.470133</td>
 871<td>18</td>
 872</tr>
 873<tr>
 874<td>GAGGG</td>
 875<td>280</td>
 876<td>1.769325</td>
 877<td>6.3283887</td>
 878<td>41</td>
 879</tr>
 880<tr>
 881<td>CACAC</td>
 882<td>380</td>
 883<td>1.7663432</td>
 884<td>5.813131</td>
 885<td>33</td>
 886</tr>
 887<tr>
 888<td>TCTGC</td>
 889<td>340</td>
 890<td>1.7647195</td>
 891<td>5.1980486</td>
 892<td>42</td>
 893</tr>
 894<tr>
 895<td>CTGGC</td>
 896<td>265</td>
 897<td>1.7596608</td>
 898<td>6.6434207</td>
 899<td>43</td>
 900</tr>
 901<tr>
 902<td>TTCAG</td>
 903<td>455</td>
 904<td>1.7527524</td>
 905<td>9.6255</td>
 906<td>12</td>
 907</tr>
 908<tr>
 909<td>AGCCA</td>
 910<td>375</td>
 911<td>1.74699</td>
 912<td>5.8319354</td>
 913<td>39</td>
 914</tr>
 915<tr>
 916<td>CTCTC</td>
 917<td>335</td>
 918<td>1.7348979</td>
 919<td>5.1761065</td>
 920<td>3</td>
 921</tr>
 922<tr>
 923<td>GGGTG</td>
 924<td>260</td>
 925<td>1.7341703</td>
 926<td>8.333022</td>
 927<td>28</td>
 928</tr>
 929<tr>
 930<td>TGGGG</td>
 931<td>260</td>
 932<td>1.7341703</td>
 933<td>8.349721</td>
 934<td>39</td>
 935</tr>
 936<tr>
 937<td>GTGGG</td>
 938<td>255</td>
 939<td>1.7008208</td>
 940<td>6.6730905</td>
 941<td>31</td>
 942</tr>
 943<tr>
 944<td>GGCCA</td>
 945<td>270</td>
 946<td>1.698549</td>
 947<td>6.293945</td>
 948<td>43</td>
 949</tr>
 950<tr>
 951<td>GCCCC</td>
 952<td>200</td>
 953<td>1.6914694</td>
 954<td>6.3460584</td>
 955<td>32</td>
 956</tr>
 957<tr>
 958<td>CTTTG</td>
 959<td>415</td>
 960<td>1.6874313</td>
 961<td>5.0799813</td>
 962<td>2</td>
 963</tr>
 964<tr>
 965<td>ACACA</td>
 966<td>485</td>
 967<td>1.6731915</td>
 968<td>5.1721287</td>
 969<td>14</td>
 970</tr>
 971<tr>
 972<td>GTGGT</td>
 973<td>320</td>
 974<td>1.6683302</td>
 975<td>5.216037</td>
 976<td>31</td>
 977</tr>
 978<tr>
 979<td>CTCAC</td>
 980<td>340</td>
 981<td>1.6681659</td>
 982<td>7.363092</td>
 983<td>31</td>
 984</tr>
 985<tr>
 986<td>TGCTT</td>
 987<td>410</td>
 988<td>1.6671008</td>
 989<td>5.090162</td>
 990<td>40</td>
 991</tr>
 992<tr>
 993<td>GGGGC</td>
 994<td>195</td>
 995<td>1.6602434</td>
 996<td>8.526694</td>
 997<td>40</td>
 998</tr>
 999<tr>
1000<td>AGTGG</td>
1001<td>335</td>
1002<td>1.654657</td>
1003<td>6.1708827</td>
1004<td>3</td>
1005</tr>
1006<tr>
1007<td>TTCTG</td>
1008<td>405</td>
1009<td>1.6467704</td>
1010<td>5.0850663</td>
1011<td>49</td>
1012</tr>
1013<tr>
1014<td>AGAAG</td>
1015<td>475</td>
1016<td>1.6460115</td>
1017<td>5.1952276</td>
1018<td>22</td>
1019</tr>
1020<tr>
1021<td>ACTCC</td>
1022<td>335</td>
1023<td>1.6436341</td>
1024<td>6.1297736</td>
1025<td>10</td>
1026</tr>
1027<tr>
1028<td>GGCTC</td>
1029<td>245</td>
1030<td>1.6268562</td>
1031<td>8.304275</td>
1032<td>46</td>
1033</tr>
1034<tr>
1035<td>TGGCA</td>
1036<td>330</td>
1037<td>1.6263331</td>
1038<td>8.637284</td>
1039<td>40</td>
1040</tr>
1041<tr>
1042<td>TCCTT</td>
1043<td>400</td>
1044<td>1.6228201</td>
1045<td>6.0946</td>
1046<td>40</td>
1047</tr>
1048<tr>
1049<td>TCTGG</td>
1050<td>310</td>
1051<td>1.612598</td>
1052<td>5.204428</td>
1053<td>43</td>
1054</tr>
1055<tr>
1056<td>GGGGA</td>
1057<td>255</td>
1058<td>1.6113497</td>
1059<td>6.3157325</td>
1060<td>7</td>
1061</tr>
1062<tr>
1063<td>CTGCT</td>
1064<td>310</td>
1065<td>1.609009</td>
1066<td>6.4845653</td>
1067<td>3</td>
1068</tr>
1069<tr>
1070<td>CCCAA</td>
1071<td>345</td>
1072<td>1.6036536</td>
1073<td>5.8073177</td>
1074<td>10</td>
1075</tr>
1076<tr>
1077<td>TGGCC</td>
1078<td>240</td>
1079<td>1.5936551</td>
1080<td>6.6434207</td>
1081<td>49</td>
1082</tr>
1083<tr>
1084<td>GTGCT</td>
1085<td>305</td>
1086<td>1.5865883</td>
1087<td>5.220104</td>
1088<td>50</td>
1089</tr>
1090<tr>
1091<td>GCTTT</td>
1092<td>390</td>
1093<td>1.5857788</td>
1094<td>6.1081944</td>
1095<td>41</td>
1096</tr>
1097<tr>
1098<td>CCACA</td>
1099<td>335</td>
1100<td>1.5571709</td>
1101<td>5.813131</td>
1102<td>30</td>
1103</tr>
1104<tr>
1105<td>CCTTC</td>
1106<td>300</td>
1107<td>1.5536399</td>
1108<td>6.4701333</td>
1109<td>17</td>
1110</tr>
1111<tr>
1112<td>CCACT</td>
1113<td>315</td>
1114<td>1.5455065</td>
1115<td>6.135909</td>
1116<td>32</td>
1117</tr>
1118<tr>
1119<td>TCTTC</td>
1120<td>380</td>
1121<td>1.5416791</td>
1122<td>5.0737495</td>
1123<td>49</td>
1124</tr>
1125<tr>
1126<td>GTTCA</td>
1127<td>400</td>
1128<td>1.5408814</td>
1129<td>7.700401</td>
1130<td>11</td>
1131</tr>
1132<tr>
1133<td>AGGCA</td>
1134<td>330</td>
1135<td>1.5407803</td>
1136<td>5.8332543</td>
1137<td>6</td>
1138</tr>
1139<tr>
1140<td>AAAAG</td>
1141<td>600</td>
1142<td>1.5396972</td>
1143<td>5.782427</td>
1144<td>41</td>
1145</tr>
1146<tr>
1147<td>GCACA</td>
1148<td>330</td>
1149<td>1.5373511</td>
1150<td>5.8202715</td>
1151<td>18</td>
1152</tr>
1153<tr>
1154<td>ATGCC</td>
1155<td>305</td>
1156<td>1.4997808</td>
1157<td>12.286893</td>
1158<td>22</td>
1159</tr>
1160<tr>
1161<td>GAAGG</td>
1162<td>320</td>
1163<td>1.4974226</td>
1164<td>5.8462653</td>
1165<td>8</td>
1166</tr>
1167<tr>
1168<td>GAGAG</td>
1169<td>320</td>
1170<td>1.4974226</td>
1171<td>5.857981</td>
1172<td>41</td>
1173</tr>
1174<tr>
1175<td>TGTGC</td>
1176<td>285</td>
1177<td>1.4825499</td>
1178<td>5.2044287</td>
1179<td>29</td>
1180</tr>
1181<tr>
1182<td>TTGGC</td>
1183<td>285</td>
1184<td>1.4825495</td>
1185<td>5.199223</td>
1186<td>15</td>
1187</tr>
1188<tr>
1189<td>GGGAT</td>
1190<td>300</td>
1191<td>1.4817826</td>
1192<td>7.40506</td>
1193<td>21</td>
1194</tr>
1195<tr>
1196<td>AGCTG</td>
1197<td>300</td>
1198<td>1.4784846</td>
1199<td>6.1633124</td>
1200<td>30</td>
1201</tr>
1202<tr>
1203<td>AACAG</td>
1204<td>425</td>
1205<td>1.4694693</td>
1206<td>5.1836653</td>
1207<td>10</td>
1208</tr>
1209<tr>
1210<td>GAGTG</td>
1211<td>295</td>
1212<td>1.4570862</td>
1213<td>6.1770606</td>
1214<td>33</td>
1215</tr>
1216<tr>
1217<td>GGGAC</td>
1218<td>230</td>
1219<td>1.4501395</td>
1220<td>6.3143044</td>
1221<td>40</td>
1222</tr>
1223<tr>
1224<td>GTGTT</td>
1225<td>355</td>
1226<td>1.4466851</td>
1227<td>6.134112</td>
1228<td>50</td>
1229</tr>
1230<tr>
1231<td>TTTGG</td>
1232<td>355</td>
1233<td>1.4466851</td>
1234<td>6.1095753</td>
1235<td>3</td>
1236</tr>
1237<tr>
1238<td>TCTTT</td>
1239<td>455</td>
1240<td>1.4461157</td>
1241<td>5.5590916</td>
1242<td>1</td>
1243</tr>
1244<tr>
1245<td>GAGAT</td>
1246<td>395</td>
1247<td>1.4447913</td>
1248<td>6.397646</td>
1249<td>27</td>
1250</tr>
1251<tr>
1252<td>CAAAA</td>
1253<td>560</td>
1254<td>1.4338523</td>
1255<td>5.123362</td>
1256<td>31</td>
1257</tr>
1258<tr>
1259<td>GGTTC</td>
1260<td>275</td>
1261<td>1.4305303</td>
1262<td>10.398446</td>
1263<td>10</td>
1264</tr>
1265<tr>
1266<td>CCCTT</td>
1267<td>275</td>
1268<td>1.4241698</td>
1269<td>5.186479</td>
1270<td>39</td>
1271</tr>
1272<tr>
1273<td>CTGTT</td>
1274<td>350</td>
1275<td>1.4231348</td>
1276<td>5.0799813</td>
1277<td>10</td>
1278</tr>
1279<tr>
1280<td>ATGGT</td>
1281<td>365</td>
1282<td>1.4091904</td>
1283<td>6.7596393</td>
1284<td>47</td>
1285</tr>
1286<tr>
1287<td>TGTTG</td>
1288<td>345</td>
1289<td>1.4059336</td>
1290<td>5.1015162</td>
1291<td>40</td>
1292</tr>
1293<tr>
1294<td>CTGTC</td>
1295<td>270</td>
1296<td>1.4013947</td>
1297<td>5.198048</td>
1298<td>39</td>
1299</tr>
1300<tr>
1301<td>GAGAC</td>
1302<td>300</td>
1303<td>1.4007094</td>
1304<td>5.856681</td>
1305<td>50</td>
1306</tr>
1307<tr>
1308<td>CTTCT</td>
1309<td>345</td>
1310<td>1.3996824</td>
1311<td>7.1246448</td>
1312<td>50</td>
1313</tr>
1314<tr>
1315<td>GGCCC</td>
1316<td>165</td>
1317<td>1.398575</td>
1318<td>6.353853</td>
1319<td>2</td>
1320</tr>
1321<tr>
1322<td>TGAGT</td>
1323<td>360</td>
1324<td>1.3898867</td>
1325<td>5.7939773</td>
1326<td>32</td>
1327</tr>
1328<tr>
1329<td>GGCAC</td>
1330<td>220</td>
1331<td>1.3840029</td>
1332<td>6.2876506</td>
1333<td>17</td>
1334</tr>
1335<tr>
1336<td>CCTTT</td>
1337<td>340</td>
1338<td>1.3793972</td>
1339<td>5.068676</td>
1340<td>8</td>
1341</tr>
1342<tr>
1343<td>CCTTG</td>
1344<td>265</td>
1345<td>1.3754432</td>
1346<td>5.187652</td>
1347<td>18</td>
1348</tr>
1349<tr>
1350<td>TTGAA</td>
1351<td>475</td>
1352<td>1.3580486</td>
1353<td>6.4295163</td>
1354<td>7</td>
1355</tr>
1356<tr>
1357<td>GAGCG</td>
1358<td>215</td>
1359<td>1.3555653</td>
1360<td>12.603353</td>
1361<td>6</td>
1362</tr>
1363<tr>
1364<td>AAGGA</td>
1365<td>390</td>
1366<td>1.3514621</td>
1367<td>5.1952276</td>
1368<td>44</td>
1369</tr>
1370<tr>
1371<td>TTCTT</td>
1372<td>420</td>
1373<td>1.3348758</td>
1374<td>7.941558</td>
1375<td>4</td>
1376</tr>
1377<tr>
1378<td>GGGGT</td>
1379<td>200</td>
1380<td>1.3339773</td>
1381<td>8.333022</td>
1382<td>45</td>
1383</tr>
1384<tr>
1385<td>CAGAT</td>
1386<td>365</td>
1387<td>1.3320893</td>
1388<td>5.4769697</td>
1389<td>34</td>
1390</tr>
1391<tr>
1392<td>CTTGG</td>
1393<td>255</td>
1394<td>1.3264918</td>
1395<td>5.1992235</td>
1396<td>18</td>
1397</tr>
1398<tr>
1399<td>TGGTT</td>
1400<td>320</td>
1401<td>1.3040541</td>
1402<td>5.091313</td>
1403<td>25</td>
1404</tr>
1405<tr>
1406<td>TTGGG</td>
1407<td>250</td>
1408<td>1.3033829</td>
1409<td>6.5135255</td>
1410<td>6</td>
1411</tr>
1412<tr>
1413<td>CTGGT</td>
1414<td>250</td>
1415<td>1.3004823</td>
1416<td>5.204428</td>
1417<td>48</td>
1418</tr>
1419<tr>
1420<td>GCTCC</td>
1421<td>195</td>
1422<td>1.2919631</td>
1423<td>8.277508</td>
1424<td>26</td>
1425</tr>
1426<tr>
1427<td>TGATG</td>
1428<td>330</td>
1429<td>1.2740628</td>
1430<td>5.7939773</td>
1431<td>46</td>
1432</tr>
1433<tr>
1434<td>TGTCC</td>
1435<td>245</td>
1436<td>1.2716361</td>
1437<td>5.187652</td>
1438<td>21</td>
1439</tr>
1440<tr>
1441<td>GGCTT</td>
1442<td>240</td>
1443<td>1.2484628</td>
1444<td>5.199223</td>
1445<td>4</td>
1446</tr>
1447<tr>
1448<td>GACAG</td>
1449<td>265</td>
1450<td>1.2372932</td>
1451<td>5.833254</td>
1452<td>27</td>
1453</tr>
1454<tr>
1455<td>GGTGT</td>
1456<td>235</td>
1457<td>1.2251799</td>
1458<td>5.21082</td>
1459<td>27</td>
1460</tr>
1461<tr>
1462<td>AATGC</td>
1463<td>335</td>
1464<td>1.2226022</td>
1465<td>10.031068</td>
1466<td>21</td>
1467</tr>
1468<tr>
1469<td>TTTGC</td>
1470<td>300</td>
1471<td>1.2198299</td>
1472<td>5.0799813</td>
1473<td>9</td>
1474</tr>
1475<tr>
1476<td>GTCCT</td>
1477<td>230</td>
1478<td>1.1937809</td>
1479<td>5.1928453</td>
1480<td>47</td>
1481</tr>
1482<tr>
1483<td>GGGCC</td>
1484<td>140</td>
1485<td>1.1893166</td>
1486<td>6.3744006</td>
1487<td>43</td>
1488</tr>
1489<tr>
1490<td>ATCCC</td>
1491<td>240</td>
1492<td>1.1775287</td>
1493<td>6.135909</td>
1494<td>43</td>
1495</tr>
1496<tr>
1497<td>GCTCT</td>
1498<td>225</td>
1499<td>1.1678292</td>
1500<td>7.789268</td>
1501<td>47</td>
1502</tr>
1503<tr>
1504<td>AGCCC</td>
1505<td>185</td>
1506<td>1.1612303</td>
1507<td>6.2799363</td>
1508<td>31</td>
1509</tr>
1510<tr>
1511<td>GATCG</td>
1512<td>235</td>
1513<td>1.1581463</td>
1514<td>6.1633124</td>
1515<td>29</td>
1516</tr>
1517<tr>
1518<td>ACCCT</td>
1519<td>230</td>
1520<td>1.128465</td>
1521<td>6.129773</td>
1522<td>10</td>
1523</tr>
1524<tr>
1525<td>GTTGG</td>
1526<td>215</td>
1527<td>1.1209095</td>
1528<td>5.2160373</td>
1529<td>47</td>
1530</tr>
1531<tr>
1532<td>AGCTC</td>
1533<td>225</td>
1534<td>1.1063956</td>
1535<td>6.1434464</td>
1536<td>25</td>
1537</tr>
1538<tr>
1539<td>CCCAT</td>
1540<td>225</td>
1541<td>1.1039332</td>
1542<td>6.129773</td>
1543<td>21</td>
1544</tr>
1545<tr>
1546<td>CGGAA</td>
1547<td>235</td>
1548<td>1.0972222</td>
1549<td>9.333206</td>
1550<td>1</td>
1551</tr>
1552<tr>
1553<td>TCTTG</td>
1554<td>265</td>
1555<td>1.0775164</td>
1556<td>5.0799813</td>
1557<td>21</td>
1558</tr>
1559<tr>
1560<td>ATGCA</td>
1561<td>295</td>
1562<td>1.0766199</td>
1563<td>5.4714913</td>
1564<td>37</td>
1565</tr>
1566<tr>
1567<td>GCTTG</td>
1568<td>205</td>
1569<td>1.0663953</td>
1570<td>5.199223</td>
1571<td>2</td>
1572</tr>
1573<tr>
1574<td>AGCGG</td>
1575<td>165</td>
1576<td>1.0403174</td>
1577<td>12.603352</td>
1578<td>7</td>
1579</tr>
1580<tr>
1581<td>TTGCC</td>
1582<td>200</td>
1583<td>1.0380702</td>
1584<td>5.1876516</td>
1585<td>3</td>
1586</tr>
1587<tr>
1588<td>AACCT</td>
1589<td>285</td>
1590<td>1.0378094</td>
1591<td>5.4593143</td>
1592<td>13</td>
1593</tr>
1594<tr>
1595<td>AACCA</td>
1596<td>300</td>
1597<td>1.0349638</td>
1598<td>5.1721287</td>
1599<td>22</td>
1600</tr>
1601<tr>
1602<td>CCGAG</td>
1603<td>160</td>
1604<td>1.0065476</td>
1605<td>12.575301</td>
1606<td>25</td>
1607</tr>
1608<tr>
1609<td>GTTCC</td>
1610<td>190</td>
1611<td>0.9861668</td>
1612<td>6.4845653</td>
1613<td>27</td>
1614</tr>
1615<tr>
1616<td>ACTCA</td>
1617<td>270</td>
1618<td>0.983188</td>
1619<td>5.4593153</td>
1620<td>11</td>
1621</tr>
1622<tr>
1623<td>CTCAT</td>
1624<td>255</td>
1625<td>0.9801258</td>
1626<td>5.7624474</td>
1627<td>4</td>
1628</tr>
1629<tr>
1630<td>GAACC</td>
1631<td>210</td>
1632<td>0.9783144</td>
1633<td>5.820272</td>
1634<td>25</td>
1635</tr>
1636<tr>
1637<td>GGCGG</td>
1638<td>110</td>
1639<td>0.93654746</td>
1640<td>10.637051</td>
1641<td>44</td>
1642</tr>
1643<tr>
1644<td>GCGGG</td>
1645<td>110</td>
1646<td>0.93654746</td>
1647<td>6.3886194</td>
1648<td>36</td>
1649</tr>
1650<tr>
1651<td>ATCGG</td>
1652<td>190</td>
1653<td>0.93637353</td>
1654<td>6.163312</td>
1655<td>30</td>
1656</tr>
1657<tr>
1658<td>GTCTG</td>
1659<td>180</td>
1660<td>0.9363471</td>
1661<td>5.2096424</td>
1662<td>41</td>
1663</tr>
1664<tr>
1665<td>GCGGT</td>
1666<td>140</td>
1667<td>0.93170583</td>
1668<td>13.303162</td>
1669<td>8</td>
1670</tr>
1671<tr>
1672<td>CGGGG</td>
1673<td>105</td>
1674<td>0.8939771</td>
1675<td>6.3886194</td>
1676<td>46</td>
1677</tr>
1678<tr>
1679<td>GGGCG</td>
1680<td>105</td>
1681<td>0.8939771</td>
1682<td>8.518159</td>
1683<td>43</td>
1684</tr>
1685<tr>
1686<td>TCGGA</td>
1687<td>170</td>
1688<td>0.83780795</td>
1689<td>7.395975</td>
1690<td>31</td>
1691</tr>
1692<tr>
1693<td>CTTGT</td>
1694<td>205</td>
1695<td>0.83355045</td>
1696<td>5.0850673</td>
1697<td>38</td>
1698</tr>
1699<tr>
1700<td>TGCCG</td>
1701<td>125</td>
1702<td>0.83002883</td>
1703<td>14.93275</td>
1704<td>23</td>
1705</tr>
1706<tr>
1707<td>AGGCG</td>
1708<td>125</td>
1709<td>0.7881193</td>
1710<td>6.3016763</td>
1711<td>15</td>
1712</tr>
1713<tr>
1714<td>CGGTT</td>
1715<td>150</td>
1716<td>0.78028923</td>
1717<td>10.398446</td>
1718<td>9</td>
1719</tr>
1720<tr>
1721<td>GTGAC</td>
1722<td>150</td>
1723<td>0.7392424</td>
1724<td>6.163313</td>
1725<td>32</td>
1726</tr>
1727<tr>
1728<td>GCCGA</td>
1729<td>115</td>
1730<td>0.723456</td>
1731<td>12.575301</td>
1732<td>24</td>
1733</tr>
1734<tr>
1735<td>CCCGC</td>
1736<td>85</td>
1737<td>0.7188745</td>
1738<td>6.3460584</td>
1739<td>30</td>
1740</tr>
1741<tr>
1742<td>CCCCG</td>
1743<td>85</td>
1744<td>0.7188745</td>
1745<td>10.576764</td>
1746<td>29</td>
1747</tr>
1748<tr>
1749<td>CGAGA</td>
1750<td>135</td>
1751<td>0.6303192</td>
1752<td>9.333206</td>
1753<td>26</td>
1754</tr>
1755<tr>
1756<td>CGGGA</td>
1757<td>90</td>
1758<td>0.5674459</td>
1759<td>6.301676</td>
1760<td>24</td>
1761</tr>
1762<tr>
1763<td>CACGG</td>
1764<td>85</td>
1765<td>0.5347284</td>
1766<td>6.2876506</td>
1767<td>37</td>
1768</tr>
1769<tr>
1770<td>CGCCT</td>
1771<td>80</td>
1772<td>0.5300361</td>
1773<td>6.6286345</td>
1774<td>30</td>
1775</tr>
1776<tr>
1777<td>CCGCA</td>
1778<td>75</td>
1779<td>0.47076905</td>
1780<td>6.2799363</td>
1781<td>36</td>
1782</tr>
1783<tr>
1784<td>CGTTG</td>
1785<td>40</td>
1786<td>0.20807713</td>
1787<td>5.2044277</td>
1788<td>46</td>
1789</tr>
1790</table>
1791</div>
1792</body></html><div class="module"><h2>Files created by FastQC</h2><table cellspacing="2" cellpadding="2">
1793<tr><td><a href="dataset_1.dat_fastqc.zip">dataset_1.dat_fastqc.zip  (312.4 KB)</a></td></tr>
1794<tr><td><a href="duplication_levels.png">duplication_levels.png  (14.5 KB)</a></td></tr>
1795<tr><td><a href="fastqc_data.txt">fastqc_data.txt  (15.0 KB)</a></td></tr>
1796<tr><td><a href="fastqc_report.html">fastqc_report.html  (25.2 KB)</a></td></tr>
1797<tr><td><a href="kmer_profiles.png">kmer_profiles.png  (186.7 KB)</a></td></tr>
1798<tr><td><a href="per_base_gc_content.png">per_base_gc_content.png  (12.1 KB)</a></td></tr>
1799<tr><td><a href="per_base_n_content.png">per_base_n_content.png  (7.4 KB)</a></td></tr>
1800<tr><td><a href="per_base_quality.png">per_base_quality.png  (9.6 KB)</a></td></tr>
1801<tr><td><a href="per_base_sequence_content.png">per_base_sequence_content.png  (23.9 KB)</a></td></tr>
1802<tr><td><a href="per_sequence_gc_content.png">per_sequence_gc_content.png  (29.6 KB)</a></td></tr>
1803<tr><td><a href="per_sequence_quality.png">per_sequence_quality.png  (21.9 KB)</a></td></tr>
1804<tr><td><a href="sequence_length_distribution.png">sequence_length_distribution.png  (18.9 KB)</a></td></tr>
1805<tr><td><a href="summary.txt">summary.txt  (465 B)</a></td></tr>
1806</table>
1807<a href="http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/">FastQC documentation and full attribution is here</a><br/><hr/>
1808FastQC was run by Galaxy using the rgenetics rgFastQC wrapper - see http://rgenetics.org for details and licensing
1809</div></div><div class="footer">Produced by <a href="http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/">FastQC</a> (version 0.10.0)</div>