PageRenderTime 14ms CodeModel.GetById 9ms app.highlight 2ms RepoModel.GetById 1ms app.codeStats 0ms

/test-data/meme/meme/meme_input_1.fasta

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 66 lines | 66 code | 0 blank | 0 comment | 0 complexity | 4f50c143affe29012876f635c9acb7a9 MD5 | raw file
 1>chr21_19617074_19617124_+
 2AAAAATTATTACTAGGGAGGGGGCCGGAACCTCGGGACGTGGGTATATAA
 3>chr21_26934381_26934431_+
 4GCGCCTGGTCGGTTATGAGTCACAAGTGAGTTATAAAAGGGTCGCACGTT
 5>chr21_28217753_28217803_-
 6CAAAGGGGAGGAGTGGGGTGGGGGTGGGGGTTTCACTGGTCCACTATAAA
 7>chr21_31710037_31710087_-
 8AACACCCAGGTTTCTGAGTATATAATCGCCGCACCAAAGAATTTAATTTT
 9>chr21_31744582_31744632_-
10CCCAGGTCTAAGAGCATATATAACTTGGAGTCCAGACTATGACATTCAAA
11>chr21_31768316_31768366_+
12AACGTATATAAATGGTCCTGTCCAGATGTGGCATGCAAACTCAGAATCTT
13>chr21_31914206_31914256_-
14TGACACCCACTACTTAGAGTATAAAATCATTCTGAGAAGTTAGAGACACC
15>chr21_31933633_31933683_-
16TCAGAGTATATATAAATGTTCCTGTCCAGTCACAGTCACCAAACTGACCT
17>chr21_31962741_31962791_-
18ACATATAACTCAGGTTGGATAAAATAATTTGTACAAATCAGGAGAGTCAA
19>chr21_31964683_31964733_+
20TCTGATTCACTGAGGCATATAAAAGGCCCTCTGCGGAGAAGTGTCCATAC
21>chr21_31973364_31973414_+
22aaacttaaaactctataaacttaaaactCTAGAATCTGATCCTGCTATAC
23>chr21_31992870_31992920_+
24CTCATACACTATTGAAGATGTATAAAATTTCATTTGCAGATGGTGACATT
25>chr21_32185595_32185645_-
26TCACCACCCACCAGAGCTGGGATATATAAAGAAGGTTCTGAGACTAGGAA
27>chr21_32202076_32202126_-
28TGCCCACCAGCTTGAGGTATAAAAAGCCCTGTACGGGAAGAGACCTTCAT
29>chr21_32253899_32253949_-
30AGCCCCACCCACCAGCAAGGATATATAAAAGCTCAGGAGTCTGGAGTGAC
31>chr21_32410820_32410870_-
32TCTACCCCACTAATCACTGAGGATGTATAAAAGTCCCAGGGAAGCTGGTG
33>chr21_36411748_36411798_-
34ATAGTTCTGTATAGTTTCAGTTGGCATCtaaaaattatataactttattt
35>chr21_37838750_37838800_-
36gatggttttataaggggcctcaccctcggctcagccctcattcttctcct
37>chr21_45705687_45705737_+
38CCGGGGCGGAGCGGCCTTTGCTCTTTGCGTGGTCGCGGGGGTATAACAGC
39>chr21_45971413_45971463_-
40CAGGCCCTGGGCATATAAAAGCCCCAGCAGCCAACAGGctcacacacaca
41>chr21_45978668_45978718_-
42CAGAGGGGTATAAAGGTTCCGACCACTCAGAGGCCTGGCACGAtcactca
43>chr21_45993530_45993580_+
44CCAAGGAGGAGTATAAAAGCCCCACAAACCCGAGCACCTCACTCACTCGC
45>chr21_46020421_46020471_+
46GAGACATATAAAAGCCAACATCCCTGAGCACCTAACACACGGactcactc
47>chr21_46031920_46031970_+
48GGAAAATACCCAGGGAGGGTATAAAACCTCAGCAGCCAGGGCACACAAAC
49>chr21_46046964_46047014_+
50ACAAGGCCAGGAGGGGTATAAAAGCCTGAGAGCCCCAAGAACctcacaca
51>chr21_46057197_46057247_+
52ATTGCTGAGTCTCCTGCTGGGAAAACACAGGCCCTGGGCATATAAAAGCC
53>chr21_46086869_46086919_-
54GACAGGTGTGCTTCTGTGCTGTGGGGATGCCTGGGCCCAGGTATAAAGGC
55>chr21_46102103_46102153_-
56AGGTGTGTGCTTCTGTGCTGTGGGGATGCCTGGGTCCAGGTATAAAGGCT
57>chr21_47517957_47518007_+
58CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG
59>chr21_47517957_47518007_+
60CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG
61>chr21_47517957_47518007_+
62CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG
63>chr21_47575506_47575556_-
64TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG
65>chr21_47575506_47575556_-
66TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG