PageRenderTime 34ms CodeModel.GetById 11ms app.highlight 16ms RepoModel.GetById 1ms app.codeStats 0ms

/static/formatHelp.html

https://bitbucket.org/cistrome/cistrome-harvard/
HTML | 665 lines | 596 code | 36 blank | 33 comment | 0 complexity | 474f0d9804a2769354e4cc782047766b MD5 | raw file
  1<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"
  2	"http://www.w3.org/TR/html4/loose.dtd">
  3<html>
  4<head>
  5<title>Galaxy Data Formats</title>
  6<meta http-equiv="Content-Type" content="text/html; charset=utf-8">
  7<meta http-equiv="Content-Style-Type" content="text/css">
  8<style type="text/css">
  9	hr  { margin-top: 3ex; margin-bottom: 1ex; border: 1px inset }
 10</style>
 11</head>
 12<body>
 13<h2>Galaxy Data Formats</h2>
 14<p>
 15<br>
 16
 17<h3>Dataset missing?</h3>
 18<p>
 19If you have a dataset in your history that is not appearing in the
 20drop-down selector for a tool, the most common reason is that it has
 21the wrong format.  Each Galaxy dataset has an associated file format
 22recorded in its metadata, and tools will only list datasets from your
 23history that have a format compatible with that particular tool.  Of
 24course some of these datasets might not actually contain relevant
 25data, or even the correct columns needed by the tool, but filtering
 26by format at least makes the list to select from a bit shorter.
 27<p>
 28Some of the formats are defined hierarchically, going from very
 29general ones like <a href="#tab">Tabular</a> (which includes any text
 30file with tab-separated columns), to more restrictive sub-formats
 31like <a href="#interval">Interval</a> (where three of the columns
 32must be the chromosome, start position, and end position), and on
 33to even more specific ones such as <a href="#bed">BED</a> that have
 34additional requirements.  So for example if a tool's required input
 35format is Tabular, then all of your history items whose format is
 36recorded as Tabular will be listed, along with those in all
 37sub-formats that also qualify as Tabular (Interval, BED, GFF, etc.).
 38<p>
 39There are two usual methods for changing a dataset's format in
 40Galaxy: if the file contents are already in the required format but
 41the metadata is wrong (perhaps because the Auto-detect feature of the
 42Upload File tool guessed it incorrectly), you can fix the metadata
 43manually by clicking on the pencil icon beside that dataset in your
 44history.  Or, if the file contents really are in a different format,
 45Galaxy provides a number of format conversion tools (e.g. in the
 46Text Manipulation and Convert Formats categories).  For instance,
 47if the tool you want to run requires Tabular but your columns are
 48delimited by spaces or commas, you can use the "Convert delimiters
 49to TAB" tool under Text Manipulation to reformat your data.  However
 50if your files are in a completely unsupported format, then you need
 51to convert them yourself before uploading.
 52<p>
 53<hr>
 54
 55<h3>Format Descriptions</h3>
 56<ul>
 57<li><a href="#ab1">AB1</a>
 58<li><a href="#axt">AXT</a>
 59<li><a href="#bam">BAM</a>
 60<li><a href="#bed">BED</a>
 61<li><a href="#bedgraph">BedGraph</a>
 62<li><a href="#binseq">Binseq.zip</a>
 63<li><a href="#fasta">FASTA</a>
 64<li><a href="#fastqsolexa">FastqSolexa</a>
 65<li><a href="#fped">FPED</a>
 66<li><a href="#gd_indivs">gd_indivs</a>
 67<li><a href="#gd_ped">gd_ped</a>
 68<li><a href="#gd_sap">gd_sap</a>
 69<li><a href="#gd_snp">gd_snp</a>
 70<li><a href="#gff">GFF</a>
 71<li><a href="#gff3">GFF3</a>
 72<li><a href="#gtf">GTF</a>
 73<li><a href="#html">HTML</a>
 74<li><a href="#interval">Interval</a>
 75<li><a href="#lav">LAV</a>
 76<li><a href="#lped">LPED</a>
 77<li><a href="#maf">MAF</a>
 78<li><a href="#mastervar">MasterVar</a>
 79<li><a href="#pbed">PBED</a>
 80<li><a href="#pgSnp">pgSnp</a>
 81<li><a href="#psl">PSL</a>
 82<li><a href="#scf">SCF</a>
 83<li><a href="#sff">SFF</a>
 84<li><a href="#table">Table</a>
 85<li><a href="#tab">Tabular</a>
 86<li><a href="#txtseqzip">Txtseq.zip</a>
 87<li><a href="#vcf">VCF</a>
 88<li><a href="#wig">Wiggle custom track</a>
 89<li><a href="#text">Other text type</a>
 90</ul>
 91<p>
 92
 93<div><a name="ab1"></a></div>
 94<hr>
 95<strong>AB1</strong>
 96<p>
 97This is one of the ABIF family of binary sequence formats from
 98Applied Biosystems Inc.
 99<!-- Their PDF
100<a href="http://www.appliedbiosystems.com/support/software_community/ABIF_File_Format.pdf"
101>format specification</a> is unfortunately password-protected. -->
102Files should have a '<code>.ab1</code>' file extension.  You must
103manually select this file format when uploading the file.
104<p>
105
106<div><a name="axt"></a></div>
107<hr>
108<strong>AXT</strong>
109<p>
110Used for pairwise alignment output from BLASTZ, after post-processing.
111Each alignment block contains three lines: a summary line and two
112sequence lines.  Blocks are separated from one another by blank lines.
113The summary line contains chromosomal position and size information
114about the alignment, and consists of nine required fields.
115<a href="http://main.genome-browser.bx.psu.edu/goldenPath/help/axt.html"
116>More information</a>
117<!-- (not available on Main)
118<dl><dt>Can be converted to:
119<dd><ul>
120<li>FASTA<br>
121Convert Formats &rarr; AXT to FASTA
122<li>LAV<br>
123Convert Formats &rarr; AXT to LAV
124</ul></dl>
125-->
126<p>
127
128<div><a name="bam"></a></div>
129<hr>
130<strong>BAM</strong>
131<p>
132A binary alignment file compressed in the BGZF format with a
133'<code>.bam</code>' file extension.
134<!-- You must manually select this file format when uploading the file. -->
135<a href="http://samtools.sourceforge.net/SAM1.pdf">SAM</a>
136is the human-readable text version of this format.
137<dl><dt>Can be converted to:
138<dd><ul>
139<li>SAM<br>
140NGS: SAM Tools &rarr; BAM-to-SAM
141<li>Pileup<br>
142NGS: SAM Tools &rarr; Generate pileup
143<li>Interval<br>
144First convert to Pileup as above, then use
145NGS: SAM Tools &rarr; Pileup-to-Interval
146</ul></dl>
147<p>
148
149<div><a name="bed"></a></div>
150<hr>
151<strong>BED</strong>
152<p>
153<ul>
154<li> also qualifies as Tabular
155<li> also qualifies as Interval
156</ul>
157This tab-separated format describes a genomic interval, but has
158strict field specifications for use in genome browsers.  BED files
159can have from 3 to 12 columns, but the order of the columns matters,
160and only the end ones can be omitted.  Some groups of columns must
161be all present or all absent.  As in Interval format (but unlike
162GFF and its relatives), the interval endpoints use a 0-based,
163half-open numbering system.
164<a href="http://main.genome-browser.bx.psu.edu/goldenPath/help/hgTracksHelp.html#BED"
165>Field specifications</a>
166<p>
167Example:
168<pre>
169chr22 1000 5000 cloneA 960 + 1000 5000 0 2 567,488, 0,3512
170chr22 2000 6000 cloneB 900 - 2000 6000 0 2 433,399, 0,3601
171</pre>
172<dl><dt>Can be converted to:
173<dd><ul>
174<li>GFF<br>
175Convert Formats &rarr; BED-to-GFF
176</ul></dl>
177<p>
178
179<div><a name="bedgraph"></a></div>
180<hr>
181<strong>BedGraph</strong>
182<p>
183<ul>
184<li> also qualifies as Tabular
185<li> also qualifies as Interval
186<li> also qualifies as BED
187</ul>
188<a href="http://main.genome-browser.bx.psu.edu/goldenPath/help/bedgraph.html"
189>BedGraph</a> is a BED file with the name column being a float value
190that is displayed as a wiggle score in tracks.  Unlike in Wiggle
191format, the exact value of this score can be retrieved after being
192loaded as a track.
193<p>
194
195<div><a name="binseq"></a></div>
196<hr>
197<strong>Binseq.zip</strong>
198<p>
199A zipped archive consisting of binary sequence files in either AB1
200or SCF format.  All files in this archive must have the same file
201extension which is one of '<code>.ab1</code>' or '<code>.scf</code>'.
202You must manually select this file format when uploading the file.
203<p>
204
205<div><a name="fasta"></a></div>
206<hr>
207<strong>FASTA</strong>
208<p>
209A sequence in 
210<a href="http://www.ncbi.nlm.nih.gov/blast/fasta.shtml">FASTA</a>
211format consists of a single-line description, followed by lines of
212sequence data.  The first character of the description line is a
213greater-than ('<code>&gt;</code>') symbol.  All lines should be
214shorter than 80 characters.
215<pre>
216>sequence1
217atgcgtttgcgtgc
218gtcggtttcgttgc
219>sequence2
220tttcgtgcgtatag
221tggcgcggtga
222</pre>
223<dl><dt>Can be converted to:
224<dd><ul>
225<li>Tabular<br>
226Convert Formats &rarr; FASTA-to-Tabular
227</ul></dl>
228<p>
229
230<div><a name="fastqsolexa"></a></div>
231<hr>
232<strong>FastqSolexa</strong>
233<p>
234<a href="http://maq.sourceforge.net/fastq.shtml">FastqSolexa</a>
235is the Illumina (Solexa) variant of the FASTQ format, which stores
236sequences and quality scores in a single file.
237<pre>
238@seq1  
239GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT  
240+seq1  
241hhhhhhhhhhhhhhhhhhhhhhhhhhPW@hhhhhh  
242@seq2  
243GCAATGACGGCAGCAATAAACTCAACAGGTGCTGG  
244+seq2  
245hhhhhhhhhhhhhhYhhahhhhWhAhFhSIJGChO
246</pre>
247Or 
248<pre>
249@seq1
250GAATTGATCAGGACATAGGACAACTGTAGGCACCAT
251+seq1
25240 40 40 40 35 40 40 40 25 40 40 26 40 9 33 11 40 35 17 40 40 33 40 7 9 15 3 22 15 30 11 17 9 4 9 4
253@seq2
254GAGTTCTCGTCGCCTGTAGGCACCATCAATCGTATG
255+seq2
25640 15 40 17 6 36 40 40 40 25 40 9 35 33 40 14 14 18 15 17 19 28 31 4 24 18 27 14 15 18 2 8 12 8 11 9
257</pre>
258<dl><dt>Can be converted to:
259<dd><ul>
260<li>FASTA<br>
261NGS: QC and manipulation &rarr; Generic FASTQ manipulation &rarr; FASTQ to FASTA
262<li>Tabular<br>
263NGS: QC and manipulation &rarr; Generic FASTQ manipulation &rarr; FASTQ to Tabular
264</ul></dl>
265<p>
266
267<div><a name="fped"></a></div>
268<hr>
269<strong>FPED</strong>
270<p>
271Also known as the FBAT format, for use with the
272<a href="http://biosun1.harvard.edu/~fbat/fbat.htm">FBAT</a> program.
273It consists of a pedigree file and a phenotype file.
274<p>
275
276<div><a name="gd_indivs"></a></div>
277<hr>
278<strong>ind</strong>
279<p>
280This format is a tabular file with the first column being the column number
281(1 based)
282from the gd_snp file where the individual/group starts.  The second column is
283the label from the metadata for the individual/group.  The third is an alias
284or blank.
285<p>
286
287<div><a name="gd_sap"></a></div>
288<hr>
289<strong>gd_sap</strong>
290<p>
291This is a tabular file describing single amino-acid polymorphisms (SAPs).
292You must manually select this file format when uploading the file.
293<!--
294<a href="http://www.bx.psu.edu/miller_lab/docs/formats/gd_sap_format.html"
295>Field specifications</a>
296-->
297<p>
298
299<div><a name="gd_snp"></a></div>
300<hr>
301<strong>gd_snp</strong>
302<p>
303This is a tabular file describing SNPs in individuals or populations.
304It contains the zero-based position of the SNP but not the range
305required by BED or interval so can not be used in Genomic Operations without
306adding an column for the end position.
307You must manually select this file format when uploading the file.
308<a href="http://www.bx.psu.edu/miller_lab/docs/formats/gd_snp_format.html"
309>Field specifications</a>
310<p>
311
312<div><a name="gff"></a></div>
313<hr>
314<strong>GFF</strong>
315<p>
316<ul>
317<li> also qualifies as Tabular
318</ul>
319GFF is a tab-separated format somewhat similar to BED, but it has
320different columns and is more flexible.  There are
321<a href="http://main.genome-browser.bx.psu.edu/FAQ/FAQformat#format3"
322>nine required fields</a>.
323Note that unlike Interval and BED, GFF and its relatives (GFF3, GTF)
324use 1-based inclusive coordinates to specify genomic intervals.
325<dl><dt>Can be converted to:
326<dd><ul>
327<li>BED<br>
328Convert Formats &rarr; GFF-to-BED
329</ul></dl>
330<p>
331
332<div><a name="gff3"></a></div>
333<hr>
334<strong>GFF3</strong>
335<p>
336<ul>
337<li> also qualifies as Tabular
338</ul>
339The <a href="http://www.sequenceontology.org/gff3.shtml">GFF3</a>
340format addresses the most common extensions to GFF, while attempting
341to preserve compatibility with previous formats.
342Note that unlike Interval and BED, GFF and its relatives (GFF3, GTF)
343use 1-based inclusive coordinates to specify genomic intervals.
344<p>
345
346<div><a name="gtf"></a></div>
347<hr>
348<strong>GTF</strong>
349<p>
350<ul>
351<li> also qualifies as Tabular
352</ul>
353<a href="http://main.genome-browser.bx.psu.edu/FAQ/FAQformat#format4"
354>GTF</a> is a format for describing genes and other features associated
355with DNA, RNA, and protein sequences.  It is a refinement to GFF that
356tightens the specification.
357Note that unlike Interval and BED, GFF and its relatives (GFF3, GTF)
358use 1-based inclusive coordinates to specify genomic intervals.
359<!-- (not available on Main)
360<dl><dt>Can be converted to:
361<dd><ul>
362<li>BedGraph<br>
363Convert Formats &rarr; GTF-to-BEDGraph
364</ul></dl>
365-->
366<p>
367
368<div><a name="html"></a></div>
369<hr>
370<strong>HTML</strong>
371<p>
372This format is an HTML web page.  Click the eye icon next to the
373dataset to view it in your browser.
374<p>
375
376<div><a name="interval"></a></div>
377<hr>
378<strong>Interval</strong>
379<p>
380<ul>
381<li> also qualifies as Tabular
382</ul>
383This Galaxy format represents genomic intervals.  It is tab-separated,
384but has the added requirement that three of the columns must be the
385chromosome name, start position, and end position, where the positions
386use a 0-based, half-open numbering system (see below).  An optional
387strand column can also be specified, and an initial header row can
388be used to label the columns, which do not have to be in any special
389order.  Arbitrary additional columns can also be present.
390<p>
391Required fields:
392<ul>
393<li>CHROM - The name of the chromosome (e.g. chr3, chrY, chr2_random)
394    or contig (e.g. ctgY1).
395<li>START - The starting position of the feature in the chromosome or
396    contig.  The first base in a chromosome is numbered 0.
397<li>END - The ending position of the feature in the chromosome or
398    contig.  This base is not included in the feature.  For example,
399    the first 100 bases of a chromosome are described as START=0,
400    END=100, and span the bases numbered 0-99.
401</ul>
402Optional:
403<ul>
404<li>STRAND - Defines the strand, either '<code>+</code>' or
405'<code>-</code>'.
406<li>Header row
407</ul>
408Example:
409<pre>
410    #CHROM  START  END    STRAND  NAME  COMMENT
411    chr1    10     100    +       exon  myExon
412    chrX    1000   10050  -       gene  myGene
413</pre>
414<dl><dt>Can be converted to:
415<dd><ul>
416<li>BED<br>
417The exact changes needed and tools to run will vary with what fields
418are in the Interval file and what type of BED you are converting to.
419In general you will likely use Text Manipulation &rarr; Compute, Cut,
420or Merge Columns.
421</ul></dl>
422<p>
423
424<div><a name="lav"></a></div>
425<hr>
426<strong>LAV</strong>
427<p>
428<a href="http://www.bx.psu.edu/miller_lab/dist/lav_format.html">LAV</a>
429is the raw pairwise alignment format that is output by BLASTZ.  The
430first line begins with <code>#:lav</code>.
431<!-- (not available on Main)
432<dl><dt>Can be converted to:
433<dd><ul>
434<li>BED<br>
435Convert Formats &rarr; LAV to BED
436</ul></dl>
437-->
438<p>
439
440<div><a name="lped"></a></div>
441<hr>
442<strong>LPED</strong>
443<p>
444This is the linkage pedigree format, which consists of separate MAP and PED
445files.  Together these files describe SNPs; the map file contains the position
446and an identifier for the SNP, while the pedigree file has the alleles.  To
447upload this format into Galaxy, do not use Auto-detect for the file format;
448instead select <code>lped</code>.  You will then be given two sections for
449uploading files, one for the pedigree file and one for the map file.  For more
450information, see
451<a href="http://www.broadinstitute.org/science/programs/medical-and-population-genetics/haploview/input-file-formats-0"
452>linkage pedigree</a>,
453<a href="http://pngu.mgh.harvard.edu/~purcell/plink/data.shtml#map">MAP</a>,
454and/or <a href="http://pngu.mgh.harvard.edu/~purcell/plink/data.shtml#ped">PED</a>.
455<dl><dt>Can be converted to:
456<dd><ul>
457<li>PBED<br>Automatic
458<li>FPED<br>Automatic
459</ul></dl>
460<p>
461
462<div><a name="maf"></a></div>
463<hr>
464<strong>MAF</strong>
465<p>
466<a href="http://main.genome-browser.bx.psu.edu/FAQ/FAQformat#format5"
467>MAF</a> is the multi-sequence alignment format that is output by TBA
468and Multiz.  The first line begins with '<code>##maf</code>'.  This
469word is followed by whitespace-separated "variable<code>=</code>value"
470pairs.  There should be no whitespace surrounding the '<code>=</code>'.
471<dl><dt>Can be converted to:
472<dd><ul>
473<li>BED<br>
474Convert Formats &rarr; MAF to BED
475<li>Interval<br>
476Convert Formats &rarr; MAF to Interval
477<li>FASTA<br>
478Convert Formats &rarr; MAF to FASTA
479</ul></dl>
480<p>
481
482<div><a name="mastervar"></a></div>
483<hr>
484<strong>MasterVar</strong>
485<p>
486MasterVar is a tab delimited text format with specified fields developed
487by the Complete Genomics life sciences company.  
488<a href="http://media.completegenomics.com/documents/DataFileFormats_Standard_Pipeline_2.2.pdf"
489>Field specifications</a>.
490<dl><dt>Can be converted to:
491<dd><ul>
492<li>pgSnp<br>
493Convert Formats &rarr; MasterVar to pgSnp
494<li>gd_snp<br>
495Convert Formats &rarr; MasterVar to gd_snp
496</ul></dl>
497<p>
498
499<div><a name="pbed"></a></div>
500<hr>
501<strong>PBED</strong>
502<p>
503This is the binary version of the LPED format.
504<dl><dt>Can be converted to:
505<dd><ul>
506<li>LPED<br>Automatic
507</ul></dl>
508<p>
509
510<div><a name="pgSnp"></a></div>
511<hr>
512<strong>pgSnp</strong>
513<p>
514This is the personal genome SNP format used by UCSC.  It is a BED-like
515format with columns chosen for the specialized display in the browser
516for personal genomes.  
517<a href="http://genome.ucsc.edu/FAQ/FAQformat.html#format10"
518>Field specifications</a>.  
519Galaxy treats it the same as an interval file.
520<p>
521
522<div><a name="psl"></a></div>
523<hr>
524<strong>PSL</strong>
525<p>
526<a href="http://main.genome-browser.bx.psu.edu/FAQ/FAQformat#format2">PSL</a>
527format is used for alignments returned by
528<a href="http://genome.ucsc.edu/cgi-bin/hgBlat?command=start">BLAT</a>.
529It does not include any sequence.
530<p>
531
532<div><a name="scf"></a></div>
533<hr>
534<strong>SCF</strong>
535<p>
536This is a binary sequence format originally designed for the Staden
537sequence handling software package.  Files should have a
538'<code>.scf</code>' file extension.  You must manually select this
539file format when uploading the file.
540<a href="http://staden.sourceforge.net/manual/formats_unix_2.html"
541>More information</a>
542<p>
543
544<div><a name="sff"></a></div>
545<hr>
546<strong>SFF</strong>
547<p>
548This is a binary sequence format used by the Roche 454 GS FLX
549sequencing machine, and is documented on p.&nbsp;528 of their
550<a href="http://sequence.otago.ac.nz/download/GS_FLX_Software_Manual.pdf"
551>software manual</a>.  Files should have a '<code>.sff</code>' file
552extension.
553<!-- You must manually select this file format when uploading the file. -->
554<dl><dt>Can be converted to:
555<dd><ul>
556<li>FASTA<br>
557Convert Formats &rarr; SFF converter
558<li>FASTQ<br>
559Convert Formats &rarr; SFF converter
560</ul></dl>
561<p>
562
563<div><a name="table"></a></div>
564<hr>
565<strong>Table</strong>
566<p>
567Text data separated into columns by something other than tabs.
568<p>
569
570<div><a name="tab"></a></div>
571<hr>
572<strong>Tabular (tab-delimited)</strong>
573<p>
574One or more columns of text data separated by tabs.
575<dl><dt>Can be converted to:
576<dd><ul>
577<li>FASTA<br>
578Convert Formats &rarr; Tabular-to-FASTA<br>
579The Tabular file must have a title and sequence column.
580<li>FASTQ<br>
581NGS: QC and manipulation &rarr; Generic FASTQ manipulation &rarr; Tabular to FASTQ
582<li>Interval<br>
583If the Tabular file has a chromosome column (or is all on one
584chromosome) and has a position column, you can create an Interval
585file (e.g. for SNPs).  If it is all on one chromosome, use
586Text Manipulation &rarr; Add column to add a CHROM column.
587If the given position is 1-based, use
588Text Manipulation &rarr; Compute with the position column minus 1 to
589get the START, and use the original given column for the END.
590If the given position is 0-based, use it as the START, and compute
591that plus 1 to get the END.
592</ul></dl>
593<p>
594
595<div><a name="txtseqzip"></a></div>
596<hr>
597<strong>Txtseq.zip</strong>
598<p>
599A zipped archive consisting of flat text sequence files.  All files
600in this archive must have the same file extension of
601'<code>.txt</code>'.  You must manually select this file format when
602uploading the file.
603<p>
604
605<div><a name="vcf"></a></div>
606<hr>
607<strong>VCF</strong>
608<p>
609Variant Call Format (VCF) is a tab delimited text file with specified
610fields.  It was developed by the 1000 Genomes Project.
611<a href="http://www.1000genomes.org/wiki/Analysis/Variant%20Call%20Format/vcf-variant-call-format-version-41"
612>Field specifications</a>.
613<dl><dt>Can be converted to:
614<dd><ul>
615<li>pgSnp<br>
616Convert Formats &rarr; VCF to pgSnp
617</ul></dl>
618<p>
619
620<div><a name="wig"></a></div>
621<hr>
622<strong>Wiggle custom track</strong>
623<p>
624Wiggle tracks are typically used to display per-nucleotide scores
625in a genome browser.  The Wiggle format for custom tracks is
626line-oriented, and the wiggle data is preceded by a track definition
627line that specifies which of three different types is being used.
628<a href="http://main.genome-browser.bx.psu.edu/goldenPath/help/wiggle.html"
629>More information</a>
630<dl><dt>Can be converted to:
631<dd><ul>
632<li>Interval<br>
633Get Genomic Scores &rarr; Wiggle-to-Interval
634<li>As a second step this could be converted to 3- or 4-column BED,
635by removing extra columns using
636Text Manipulation &rarr; Cut columns from a table.
637</ul></dl>
638<p>
639
640<div><a name="gd_ped"></a></div>
641<hr>
642<strong>gd_ped</strong>
643<p>
644Similar to the linkage pedigree format (lped).  
645<p>
646
647<div><a name="text"></a></div>
648<hr>
649<strong>Other text type</strong>
650<p>
651Any text file.
652<dl><dt>Can be converted to:
653<dd><ul>
654<li>Tabular<br>
655If the text has fields separated by spaces, commas, or some other
656delimiter, it can be converted to Tabular by using
657Text Manipulation &rarr; Convert delimiters to TAB.
658</ul></dl>
659<p>
660
661<!-- blank lines so internal links will jump farther to end -->
662<br><br><br><br><br><br><br><br><br><br><br><br>
663<br><br><br><br><br><br><br><br><br><br><br><br>
664</body>
665</html>