PageRenderTime 15ms CodeModel.GetById 10ms app.highlight 1ms RepoModel.GetById 1ms app.codeStats 1ms

/lib/galaxy/datatypes/test/sequence.maf

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 8 lines | 8 code | 0 blank | 0 comment | 0 complexity | 61e5bd1cad07623434268632a88e6bc9 MD5 | raw file
1##maf version=1
2a score=581086.0
3s human.chr7                 115444712 27 + 158628139 ATGGACCTGGAAAACAAAGTGAAGAAG 
4s colobus_monkey.1               49230 27 +   1990688 ATGGACCTGGAAAACAAAGTGAAGAAG 
5s baboon.1                       91916 27 +   1730495 ATGGACCTGGAAAACAAAGTGAAGAAG 
6s macaque.SCAFFOLD85017         143691 27 -    166989 ATGGACCTGGAAAACAAAGTGAAGAAG 
7s dusky_titi.1                   91348 27 +   2096432 ATGGACCTGGAAAACAAAGTGAAGAAG 
8s owl_monkey.1                  132506 27 +   2053814 ATGGACCTGGAAAACAAAGTGAAGAAG