PageRenderTime 26ms CodeModel.GetById 17ms app.highlight 4ms RepoModel.GetById 1ms app.codeStats 1ms

/tools/next_gen_conversion/fastq_conversions.xml

https://bitbucket.org/cistrome/cistrome-harvard/
XML | 133 lines | 126 code | 7 blank | 0 comment | 0 complexity | d5fbdc397c5d3cd0e122eeb5d72e6d13 MD5 | raw file
  1<tool id="fastq_conversions" name="FASTQ Conversions" version="1.0.0">
  2  <description>converts between FASTQ data and other data formats</description>
  3  <command interpreter="python">
  4    fastq_conversions.py 
  5    --command=$conversionType.type
  6    --input=$input
  7    #if $conversionType.type == "sol2std":
  8     --outputFastqsanger=$outputFastqsanger
  9    #else:
 10     --outputFastqsanger="None"
 11    #end if
 12    #if $conversionType.type == "std2sol":
 13     --outputFastqsolexa=$outputFastqsolexa
 14    #else:
 15     --outputFastqsolexa="None"
 16    #end if
 17    #if $conversionType.type == "fq2fa":
 18     --outputFasta=$outputFasta
 19    #else:
 20     --outputFasta="None"
 21    #end if
 22  </command>
 23  <inputs>
 24    <conditional name="conversionType">
 25      <param name="type" type="select" label="What type of conversion do you want to do?">
 26        <option value="sol2std">Solexa/Illumina FASTQ to standard Sanger FASTQ</option>
 27        <option value="std2sol">Standard Sanger FASTQ to Solexa/Illumina FASTQ</option>
 28        <option value="fq2fa">Various FASTQ to FASTA</option>
 29      </param>
 30      <when value="sol2std">
 31        <param name="input" type="data" format="fastqsolexa" label="File to convert" />
 32      </when>
 33      <when value="std2sol">
 34        <param name="input" type="data" format="fastqsanger" label="File to convert" />
 35      </when>
 36      <when value="fq2fa">
 37        <param name="input" type="data" format="fastqsolexa, fastqsanger" label="File to convert" />
 38      </when>
 39    </conditional>
 40  </inputs>
 41  <outputs>
 42    <data name="outputFastqsanger" format="fastqsanger">
 43      <filter>conversionType['type'] == 'sol2std'</filter>
 44    </data>
 45    <data name="outputFastqsolexa" format="fastqsolexa">
 46      <filter>conversionType['type'] == 'std2sol'</filter>
 47    </data>
 48    <data name="outputFasta" format="fasta">
 49      <filter>conversionType['type'] == 'fq2fa'</filter>
 50    </data>
 51  </outputs>
 52  <tests>
 53    <test>
 54      <param name="type" value="sol2std" />
 55      <param name="input" value="fastq_conv_in1.fastq" ftype="fastqsolexa" />
 56      <output name="outputFastqsanger" file="fastq_conv_out1.fastqsanger" />
 57    </test>
 58    <test>
 59      <param name="type" value="std2sol" />
 60      <param name="input" value="1.fastqsanger" ftype="fastqsanger" />
 61      <output name="outputFastqsolexa" file="fastq_conv_out2.fastqsolexa" />
 62    </test>
 63    <test>
 64      <param name="type" value="fq2fa" />
 65      <param name="input" value="1.fastqsanger" ftype="fastqsanger" />
 66      <output name="outputFasta" file="fastq_conv_out4.fasta" />
 67    </test>
 68  </tests>
 69  <help>
 70**What it does**
 71
 72This tool offers several conversions options relating to the FASTQ format. 
 73
 74-----
 75
 76**Examples**
 77
 78- Converting the Solexa/Illumina FASTQ data::
 79
 80	@081017-and-081020:1:1:1715:1759
 81	GGACTCAGATAGTAATCCACGCTCCTTTAAAATATC
 82	+
 83	II#IIIIIII$5+.(9IIIIIII$%*$G$A31I&amp;&amp;B
 84
 85- will produce the following Sanger FASTQ data::
 86
 87	@081017-and-081020:1:1:1715:1759
 88	GGACTCAGATAGTAATCCACGCTCCTTTAAAATATC
 89	+
 90	++!+++++++!!!!!"+++++++!!!!)!%!!+!!%!
 91	
 92- Converting standard Sanger FASTQ::
 93    
 94    @1831_573_1004/1
 95	AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG
 96	+
 97	>&lt;C&amp;&amp;9952+C>5&lt;.?&lt;79,=42&lt;292:&lt;(9/-7
 98	@1831_573_1050/1
 99	TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT
100	+
101	;@@17?@=>7??@A8?==@4A?A4)&amp;+.'&amp;+'1,
102
103- will produce the following Solexa/Illumina FASTQ data::
104
105	@1831_573_1004/1
106	AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG
107	+
108	][bEEXXTQJb]T[M^[VXK\SQ[QXQY[GXNLV
109	@1831_573_1050/1
110	TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT
111	+
112	Z__PV^_\]V^^_`W^\\_S`^`SHEJMFEJFPK
113
114- Converting the Sanger FASTQ data::
115
116    @1831_573_1004/1
117	AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG
118	+
119	>&lt;C&amp;&amp;9952+C>5&lt;.?&lt;79,=42&lt;292:&lt;(9/-7
120	@1831_573_1050/1
121	TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT
122	+
123	;@@17?@=>7??@A8?==@4A?A4)&amp;+.'&amp;+'1,
124	
125- will produce the following FASTA data::
126
127	>1831_573_1004/1
128	AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG
129	>1831_573_1050/1
130	TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT
131
132  </help>
133</tool>