PageRenderTime 58ms CodeModel.GetById 48ms app.highlight 4ms RepoModel.GetById 1ms app.codeStats 0ms

/tools/fastq/fastq_paired_end_interlacer.xml

https://bitbucket.org/cistrome/cistrome-harvard/
XML | 72 lines | 55 code | 14 blank | 3 comment | 0 complexity | f118d25decb7c7f205ae38badef2e7e6 MD5 | raw file
 1<tool id="fastq_paired_end_interlacer" name="FASTQ interlacer" version="1.1">
 2  <description>on paired end reads</description>
 3  <command interpreter="python">fastq_paired_end_interlacer.py '$input1_file' '${input1_file.extension[len( 'fastq' ):]}' '$input2_file' '${input2_file.extension[len( 'fastq' ):]}' '$outfile_pairs' '$outfile_singles'</command>
 4  <inputs>
 5    <param name="input1_file" type="data" format="fastqsanger,fastqcssanger" label="Left-hand mates" />
 6    <param name="input2_file" type="data" format="fastqsanger,fastqcssanger" label="Right-hand mates" />
 7  </inputs>
 8  <outputs>
 9    <!-- $input1_file.name = filename  , e.g. paired_end_2_errors.fastqsanger -->
10    <!-- $input1_file.id   = ID        , e.g. 10 -->
11    <!-- $input1_file.hid  = history ID, e.g. 5  -->
12    <data name="outfile_pairs"   format="input" label="FASTQ interlacer pairs from data ${input1_file.hid} and data ${input2_file.hid}"/>
13    <data name="outfile_singles" format="input" label="FASTQ interlacer singles from data ${input1_file.hid} and data ${input2_file.hid}"/>
14  </outputs>
15  <tests>
16    <test>
17      <param name="input1_file" value="paired_end_1.fastqsanger" ftype="fastqsanger" />
18      <param name="input2_file" value="paired_end_2.fastqsanger" ftype="fastqsanger" />
19      <output name="outfile_pairs" file="paired_end_merged.fastqsanger" />
20      <output name="outfile_singles" file="paired_end_merged_singles.fastqsanger" />
21    </test>
22    <test>
23      <param name="input1_file" value="paired_end_1_errors.fastqsanger" ftype="fastqsanger" />
24      <param name="input2_file" value="paired_end_2_errors.fastqsanger" ftype="fastqsanger" />
25      <output name="outfile_pairs" file="paired_end_merged_cleaned.fastqsanger" />
26      <output name="outfile_singles" file="paired_end_merged_cleaned_singles.fastqsanger" />
27    </test>
28  </tests>
29  <help>
30**What it does**
31
32This tool joins paired end FASTQ reads from two separate files, one with the left mates and one with the right mates, into a single files where left mates alternate with their right mates. The join is performed using sequence identifiers, allowing the two files to contain differing ordering. If a sequence identifier does not appear in both files, it is included in a separate file.
33
34Sequence identifiers with /1 and /2 appended override the left-hand and right-hand designation; i.e. if the reads end with /1 and /2, the read containing /1 will be used as the left-hand read and the read containing /2 will be used as the right-hand read. Sequences without this designation will follow the left-hand and right-hand settings set by the user.
35
36-----
37
38**Input**
39
40Left-hand mates, for example::
41
42    @1539:931/1
43    ACTTCCCGCGCGTGAAGGCGCCGGCAAACGAGGCTCGGGAAGGGGCTCCCG
44    +1539:931/1
45    BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
46
47Right-hand mates, for example::
48
49    @1539:931/2
50    CGCCATTCCGAATCGTAGTTGTCGGCGTCTTCCAGTGCGGCAAGGCATCGT
51    +1539:931/2
52    WNUUZ\P^`BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
53
54-----
55
56**Output**
57
58A multiple-fastq file containing interlaced left and right paired reads::
59
60    @1539:931/1
61    ACTTCCCGCGCGTGAAGGCGCCGGCAAACGAGGCTCGGGAAGGGGCTCCCG
62    +1539:931/1
63    BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
64    @1539:931/2
65    CGCCATTCCGAATCGTAGTTGTCGGCGTCTTCCAGTGCGGCAAGGCATCGT
66    +1539:931/2
67    WNUUZ\P^`BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
68
69A multiple-fastq file containing reads that have no mate is also produced.
70
71  </help>
72</tool>