PageRenderTime 23ms CodeModel.GetById 15ms app.highlight 2ms RepoModel.GetById 2ms app.codeStats 0ms

/tools/fastx_toolkit/fastx_renamer.xml

https://bitbucket.org/cistrome/cistrome-harvard/
XML | 65 lines | 45 code | 19 blank | 1 comment | 0 complexity | aca60d780dc0ba6543cf73c890fdebfc MD5 | raw file
 1<tool id="cshl_fastx_renamer" name="Rename sequences" version="0.0.11" >
 2	<description></description>
 3	<requirements><requirement type="package">fastx_toolkit</requirement></requirements>
 4	<command>zcat -f $input | fastx_renamer -n $TYPE -o $output -v 
 5#if $input.ext == "fastqsanger":
 6-Q 33
 7#end if
 8	</command>
 9
10	<inputs>
11		<param format="fastqsolexa,fasta,fastqsanger" name="input" type="data" label="FASTQ/A Library to rename" />
12
13		<param name="TYPE" type="select" label="Rename sequence identifiers to">
14			<option value="SEQ">Nucleotides sequence</option>
15			<option value="COUNT">Numeric Counter</option>
16		</param>
17	</inputs>
18
19	<outputs>
20		<data format="input" name="output" metadata_source="input" />
21	</outputs>
22
23<help>
24
25**What it does**
26
27This tool renames the sequence identifiers in a FASTQ/A file.
28
29.. class:: infomark
30
31Use this tool at the beginning of your workflow, as a way to keep the original sequence (before trimming, clipping, barcode-removal, etc).
32
33--------
34
35**Example**
36
37The following Solexa-FASTQ file::
38
39    @CSHL_4_FC042GAMMII_2_1_517_596
40    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
41    +CSHL_4_FC042GAMMII_2_1_517_596
42    40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
43  
44Renamed to **nucleotides sequence**::
45
46    @GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
47    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
48    +GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
49    40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
50
51Renamed to **numeric counter**::
52
53    @1
54    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
55    +1
56    40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
57
58------
59
60This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
61
62 .. __: http://hannonlab.cshl.edu/fastx_toolkit/   
63</help>
64</tool>
65<!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->