PageRenderTime 21ms CodeModel.GetById 13ms app.highlight 3ms RepoModel.GetById 1ms app.codeStats 0ms

/tools/fastx_toolkit/fastq_to_fasta.xml

https://bitbucket.org/cistrome/cistrome-harvard/
XML | 80 lines | 57 code | 20 blank | 3 comment | 0 complexity | e76f49255f5cb23e9e6b4479fbf21cfa MD5 | raw file
 1<tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA">
 2	<description>converter</description>
 3	<requirements><requirement type="package">fastx_toolkit</requirement></requirements>
 4	<command>gunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v 
 5#if $input.ext == "fastqsanger":
 6-Q 33
 7#end if
 8	</command>
 9
10	<inputs>
11		<param format="fastqsanger,fastqsolexa,fastqillumina" name="input" type="data" label="FASTQ Library to convert" />
12
13		<param name="SKIPN" type="select" label="Discard sequences with unknown (N) bases ">
14			<option value="">yes</option>
15			<option value="-n">no</option>
16		</param>
17
18		<param name="RENAMESEQ" type="select" label="Rename sequence names in output file (reduces file size)">
19			<option value="-r">yes</option>
20			<option value="">no</option>
21		</param>
22
23	</inputs>
24
25	<tests>
26		<test>
27			<!-- FASTQ-To-FASTA, keep N, don't rename -->
28			<param name="input" value="fastq_to_fasta1.fastq" ftype="fastqsolexa" />
29			<param name="SKIPN" value=""/>
30			<param name="RENAMESEQ" value=""/>
31			<output name="output" file="fastq_to_fasta1a.out" />
32		</test>
33		<test>
34			<!-- FASTQ-To-FASTA, discard N, rename -->
35			<param name="input" value="fastq_to_fasta1.fastq" ftype="fastqsolexa" />
36			<param name="SKIPN" value="no"/>
37			<param name="RENAMESEQ" value="yes"/>
38			<output name="output" file="fastq_to_fasta1b.out" />
39		</test>
40	</tests>
41
42	<outputs>
43		<data format="fasta" name="output" metadata_source="input" />
44	</outputs>
45
46<help>
47
48**What it does**
49
50This tool converts data from Solexa format to FASTA format (scroll down for format description).
51
52--------
53
54**Example**
55
56The following data in Solexa-FASTQ format::
57
58    @CSHL_4_FC042GAMMII_2_1_517_596
59    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
60    +CSHL_4_FC042GAMMII_2_1_517_596
61    40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
62  
63Will be converted to FASTA (with 'rename sequence names' = NO)::
64
65    >CSHL_4_FC042GAMMII_2_1_517_596
66    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
67    
68Will be converted to FASTA (with 'rename sequence names' = YES)::
69
70    >1
71    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
72    
73------
74
75This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
76
77 .. __: http://hannonlab.cshl.edu/fastx_toolkit/    
78</help>
79</tool>
80<!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->