PageRenderTime 14ms CodeModel.GetById 5ms app.highlight 4ms RepoModel.GetById 1ms app.codeStats 1ms

/tools/fastx_toolkit/fasta_formatter.xml

https://bitbucket.org/cistrome/cistrome-harvard/
XML | 87 lines | 57 code | 19 blank | 11 comment | 0 complexity | 8b921702d94023ab58dc11d8f4df842c MD5 | raw file
 1<tool id="cshl_fasta_formatter" name="FASTA Width">
 2	<description>formatter</description>
 3	<requirements><requirement type="package">fastx_toolkit</requirement></requirements>
 4	<!--
 5		Note:
 6			fasta_formatter also has a tabular output mode (-t),
 7			but Galaxy already contains such a tool, so no need
 8			to offer the user a duplicated tool.
 9
10			So this XML tool only changes the width (line-wrapping) of a
11			FASTA file.
12	-->
13	<command>zcat -f '$input' | fasta_formatter -w $width -o $output</command>
14	<inputs>
15		<param format="fasta" name="input" type="data" label="Library to re-format" />
16
17		<param name="width" type="integer" value="0" label="New width for nucleotides strings" help="Use 0 for single line out." />
18	</inputs>
19
20	<tests>
21		<test>
22			<!-- Re-format a FASTA file into a single line -->
23			<param name="input" value="fasta_formatter1.fasta" /> 
24			<param name="width" value="0" />
25			<output name="output" file="fasta_formatter1.out" />
26		</test>
27		<test>
28			<!-- Re-format a FASTA file into multiple lines wrapping at 60 charactes -->
29			<param name="input" value="fasta_formatter1.fasta" />
30			<param name="width" value="60" />
31			<output name="output" file="fasta_formatter2.out" />
32		</test>
33	</tests>
34
35	<outputs>
36		<data format="input" name="output" metadata_source="input" />
37	</outputs>
38
39<help>
40**What it does**
41
42This tool re-formats a FASTA file, changing the width of the nucleotides lines.
43  
44**TIP:** Outputting a single line (with **width = 0**) can be useful for scripting (with **grep**, **awk**, and **perl**). Every odd line is a sequence identifier, and every even line is a nucleotides line.
45
46--------
47
48**Example**
49
50Input FASTA file (each nucleotides line is 50 characters long)::
51
52    >Scaffold3648
53    AGGAATGATGACTACAATGATCAACTTAACCTATCTATTTAATTTAGTTC
54    CCTAATGTCAGGGACCTACCTGTTTTTGTTATGTTTGGGTTTTGTTGTTG
55    TTGTTTTTTTAATCTGAAGGTATTGTGCATTATATGACCTGTAATACACA
56    ATTAAAGTCAATTTTAATGAACATGTAGTAAAAACT
57    >Scaffold9299
58    CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAG
59    TCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAG
60    aactggtctttacctTTAAGTTG
61
62
63Output FASTA file (with width=80)::
64
65    >Scaffold3648
66    AGGAATGATGACTACAATGATCAACTTAACCTATCTATTTAATTTAGTTCCCTAATGTCAGGGACCTACCTGTTTTTGTT
67    ATGTTTGGGTTTTGTTGTTGTTGTTTTTTTAATCTGAAGGTATTGTGCATTATATGACCTGTAATACACAATTAAAGTCA
68    ATTTTAATGAACATGTAGTAAAAACT
69    >Scaffold9299
70    CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAGTCTTCGGTCATAACACAAACCCAGACCTAC
71    GTATATGACAAAGCTAATAGaactggtctttacctTTAAGTTG
72
73Output FASTA file (with width=0 => single line)::
74
75    >Scaffold3648
76    AGGAATGATGACTACAATGATCAACTTAACCTATCTATTTAATTTAGTTCCCTAATGTCAGGGACCTACCTGTTTTTGTTATGTTTGGGTTTTGTTGTTGTTGTTTTTTTAATCTGAAGGTATTGTGCATTATATGACCTGTAATACACAATTAAAGTCAATTTTAATGAACATGTAGTAAAAACT
77    >Scaffold9299
78    CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAGTCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAGaactggtctttacctTTAAGTTG
79
80------
81
82This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
83
84 .. __: http://hannonlab.cshl.edu/fastx_toolkit/
85 
86</help>
87</tool>