PageRenderTime 30ms CodeModel.GetById 19ms app.highlight 5ms RepoModel.GetById 1ms app.codeStats 1ms

/tools/maf/interval2maf.xml

https://bitbucket.org/cistrome/cistrome-harvard/
XML | 294 lines | 236 code | 51 blank | 7 comment | 0 complexity | 2b8d4e35baab2c55e75706b656df6d6c MD5 | raw file
  1<tool id="Interval2Maf1" name="Extract MAF blocks" version="1.0.1">
  2  <description>given a set of genomic intervals</description>
  3  <command interpreter="python">
  4    #if $maf_source_type.maf_source == "user" #interval2maf.py --dbkey=${input1.dbkey} --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafFile=$maf_source_type.mafFile --mafIndex=$maf_source_type.mafFile.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --mafIndexFile=${GALAXY_DATA_INDEX_DIR}/maf_index.loc --species=$maf_source_type.species
  5    #else                                     #interval2maf.py --dbkey=${input1.dbkey} --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafType=$maf_source_type.mafType --interval_file=$input1 --output_file=$out_file1 --mafIndexFile=${GALAXY_DATA_INDEX_DIR}/maf_index.loc --species=$maf_source_type.species
  6    #end if# --split_blocks_by_species=$split_blocks_by_species_selector.split_blocks_by_species
  7    #if $split_blocks_by_species_selector.split_blocks_by_species == "split_blocks_by_species"#
  8        --remove_all_gap_columns=$split_blocks_by_species_selector.remove_all_gap_columns
  9    #end if
 10  </command>
 11  <inputs>
 12    <param format="interval" name="input1" type="data" label="Choose intervals">
 13      <validator type="unspecified_build" />
 14    </param>
 15    <conditional name="maf_source_type">
 16      <param name="maf_source" type="select" label="MAF Source">
 17        <option value="cached" selected="true">Locally Cached Alignments</option>
 18        <option value="user">Alignments in Your History</option>
 19      </param>
 20      <when value="user">
 21        <param format="maf" name="mafFile" label="Choose alignments" type="data">
 22          <options>
 23            <filter type="data_meta" ref="input1" key="dbkey" />
 24          </options>
 25          <validator type="dataset_ok_validator" />
 26        </param>
 27        <param name="species" type="select" display="checkboxes" multiple="true" label="Choose species" help="Select species to be included in the final alignment">
 28          <options>
 29            <filter type="data_meta" ref="mafFile" key="species" />
 30          </options>
 31        </param>
 32      </when>
 33      <when value="cached">
 34        <param name="mafType" type="select" label="Choose alignments">
 35          <options from_data_table="indexed_maf_files">
 36            <!--
 37            <column name="name" index="0"/>
 38            <column name="value" index="1"/>
 39            <column name="dbkey" index="2"/>
 40            <column name="species" index="3"/>
 41            -->
 42            <filter type="data_meta" ref="input1" key="dbkey" column="dbkey" multiple="True" separator=","/>
 43            <validator type="no_options" message="No alignments are available for the build associated with the selected interval file"/>
 44          </options>
 45        </param>
 46        <param name="species" type="select" display="checkboxes" multiple="true" label="Choose species" help="Select species to be included in the final alignment">
 47          <options from_data_table="indexed_maf_files">
 48            <column name="uid" index="1"/>
 49            <column name="value" index="3"/>
 50            <column name="name" index="3"/>
 51            <filter type="param_value" ref="mafType" column="uid"/>
 52            <filter type="multiple_splitter" column="name" separator=","/>
 53          </options>
 54        </param>
 55      </when>
 56    </conditional>
 57    <conditional name="split_blocks_by_species_selector">
 58      <param name="split_blocks_by_species" type="select" label="Split blocks by species" help="Not usually applicable. See help below for more information.">
 59        <option value="split_blocks_by_species">Split by species</option>
 60        <option value="dont_split_blocks_by_species" selected="true">Do not split</option>
 61      </param>
 62      <when value="dont_split_blocks_by_species">
 63        <!-- do nothing here -->
 64      </when>
 65      <when value="split_blocks_by_species">
 66        <param name="remove_all_gap_columns" type="select" label="Collapse empty alignment columns">
 67          <option value="remove_all_gap_columns" selected="true">Collapse empty columns</option>
 68          <option value="do_not_remove_all_gap_columns">Do not collapse</option>
 69        </param>
 70      </when>
 71    </conditional>
 72   </inputs>
 73   <outputs>
 74     <data format="maf" name="out_file1"/>
 75   </outputs>
 76   <tests>
 77     <test>
 78       <param name="input1" value="1.bed"/>
 79       <param name="maf_source" value="cached"/>
 80       <param name="mafType" value="ENCODE_TBA_hg17"/>
 81       <param name="species" value="hg17,panTro1,baboon,marmoset,galago,rn3,mm6,rabbit,cow,canFam1,rfbat,shrew,armadillo,tenrec,monDom1,tetNig1,fr1,rheMac1,galGal2,xenTro1,danRer2,elephant,platypus,hedgehog,colobus_monkey,dusky_titi,owl_monkey,mouse_lemur"/>
 82       <param name="split_blocks_by_species" value="dont_split_blocks_by_species"/>
 83       <output name="out_file1" file="fsa_interval2maf.dat" />
 84     </test>
 85     <test>
 86       <param name="input1" value="1.bed"/>
 87       <param name="maf_source" value="user"/>
 88       <param name="mafFile" value="fsa_interval2maf.dat"/>
 89       <param name="species" value="hg17,panTro1,baboon,marmoset,galago,rn3,mm6,rabbit,cow,canFam1,rfbat,shrew,armadillo,tenrec,monDom1,tetNig1,fr1,rheMac1,galGal2,xenTro1,danRer2,elephant,platypus,hedgehog,colobus_monkey,dusky_titi,owl_monkey,mouse_lemur"/>
 90       <param name="split_blocks_by_species" value="dont_split_blocks_by_species"/>
 91       <output name="out_file1" file="fsa_interval2maf.dat" />
 92     </test>
 93     <test>
 94       <param name="input1" value="1.bed" dbkey="hg18" ftype="bed"/>
 95       <param name="maf_source" value="cached"/>
 96       <param name="mafType" value="28_WAY_MULTIZ_hg18"/>
 97       <param name="species" value="hg18,panTro2,mm8"/>
 98       <param name="split_blocks_by_species" value="dont_split_blocks_by_species"/>
 99       <output name="out_file1" file="interval2maf_3from28way.maf" />
100     </test>
101   </tests>
102   <help>
103**What it does**
104
105This tool takes genomic coordinates, superimposes them on multiple alignments (in MAF format) stored on the Galaxy site or from your history, and excises alignment blocks corresponding to each set of coordinates. Alignment blocks that extend past START and/or END positions of an interval are trimmed. Note that a single genomic interval may correspond to two or more alignment blocks. 
106
107-----
108
109**Example** 
110
111Here a single interval is superimposed on three MAF blocks. Blocks 1 and 3 are trimmed because they extend beyond boundaries of the interval:
112
113.. image:: ${static_path}/images/maf_icons/interval2maf.png
114
115-------
116
117**Split blocks by species**
118
119This option examines each MAF block for multiple occurrences of a species in a single block. When this occurs, a block is split into multiple blocks where every combination of one sequence per species per block is represented.
120
121The interface for this option has two inputs: 
122
123 * **MAF file to split**. Choose multiple alignments from history to be split by species.
124 * **Collapse empty alignment columns**. Should alignment columns containing only gaps in the new blocks be removed.
125
126
127
128**Example 1**: **Collapse empty alignment columns is Yes**:
129
130For the following alignment::
131
132  ##maf version=1
133  a score=2047408.0
134  s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG 
135  s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG 
136  s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG 
137  s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG 
138  s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
139  s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
140  s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG 
141  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
142
143the tool will create **a single** history item containing 12 alignment blocks (notice that no columns contain only gaps)::
144
145  ##maf version=1
146  a score=2047408.0
147  s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG 
148  s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
149  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
150  
151  a score=2047408.0
152  s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG 
153  s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
154  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
155  
156  a score=2047408.0
157  s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG 
158  s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
159  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
160  
161  a score=2047408.0
162  s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG 
163  s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
164  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
165  
166  a score=2047408.0
167  s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG 
168  s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
169  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
170  
171  a score=2047408.0
172  s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT-GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG 
173  s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT-GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
174  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC--GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
175 
176  a score=2047408.0
177  s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG 
178  s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
179  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
180  
181  a score=2047408.0
182  s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC-GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG 
183  s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
184  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC-GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
185  
186  a score=2047408.0
187  s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG 
188  s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG 
189  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
190  
191  a score=2047408.0
192  s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG 
193  s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG 
194  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
195  
196  a score=2047408.0
197  s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTAG 
198  s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCAG 
199  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGCAG 
200  
201  a score=2047408.0
202  s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCAG 
203  s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC---AG 
204  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC---AG 
205
206
207
208**Example 2**: **Collapse empty alignment columns is No**:
209
210For the following alignment::
211
212  ##maf version=1
213  a score=2047408.0
214  s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG 
215  s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG 
216  s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG 
217  s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG 
218  s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
219  s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
220  s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG 
221  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
222
223the tool will create **a single** history item containing 12 alignment blocks (notice that some columns contain only gaps)::
224
225  ##maf version=1
226  a score=2047408.0
227  s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG 
228  s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
229  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
230  
231  a score=2047408.0
232  s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG 
233  s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
234  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
235  
236  a score=2047408.0
237  s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG 
238  s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
239  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
240  
241  a score=2047408.0
242  s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG 
243  s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
244  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
245  
246  a score=2047408.0
247  s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG 
248  s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
249  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
250  
251  a score=2047408.0
252  s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG 
253  s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
254  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
255  
256  a score=2047408.0
257  s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG 
258  s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
259  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
260  
261  a score=2047408.0
262  s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG 
263  s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG 
264  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
265  
266  a score=2047408.0
267  s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG 
268  s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG 
269  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
270  
271  a score=2047408.0
272  s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG 
273  s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG 
274  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
275  
276  a score=2047408.0
277  s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG 
278  s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG 
279  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
280  
281  a score=2047408.0
282  s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG 
283  s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG 
284  s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
285
286------
287
288**Citation**
289
290If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_
291
292
293  </help>
294</tool>