PageRenderTime 27ms CodeModel.GetById 18ms app.highlight 3ms RepoModel.GetById 1ms app.codeStats 0ms

/tools/emboss_5/emboss_isochore.xml

https://bitbucket.org/cistrome/cistrome-harvard/
XML | 88 lines | 53 code | 19 blank | 16 comment | 0 complexity | 13687829c173d9b2bd8f81875d0753a1 MD5 | raw file
 1<tool id="EMBOSS: isochore47" name="isochore" version="5.0.0">
 2  <description>Plots isochores in large DNA sequences</description>
 3  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
 4  <command interpreter="perl">emboss_single_outputfile_wrapper.pl isochore -sequence $input1 -outfile $ofile2 -goutfile $ofile1 -graph png -window $window -shift $shift -auto</command>
 5  <!--  <command interpreter="perl">emboss_single_outputfile_wrapper.pl isochore -sequence $input1 -goutfile $ofile1 -graph png -window $window -shift $shift -auto</command>-->
 6  <inputs>
 7    <param format="fasta" name="input1" type="data">
 8      <label>Sequences</label>
 9    </param>
10    <param name="window" size="4" type="text" value="1000">
11      <label>Window size</label>
12    </param>
13    <param name="shift" size="4" type="text" value="100">
14      <label>Shift increment</label>
15    </param>
16  </inputs>
17  <outputs>
18    <data format="png" name="ofile1" />
19    <data format="isochore" name="ofile2" />
20  </outputs>
21  <!-- <tests>
22    <test>
23      <param name="input1" value="2.fasta"/>
24      <param name="window" value="1000"/>
25      <param name="shift" value="100"/>
26      <output name="ofile1" file="emboss_isochore_out.isochore"/> 
27      <output name="ofile2" file="emboss_isochore_out.isochore"/>
28    </test>
29         <test>
30      <param name="input1" value="2.fasta"/>
31      <param name="window" value="1000"/>
32      <param name="shift" value="100"/>
33      <output name="ofile2" file="emboss_isochore_out.isochore"/>
34    </test> 
35  </tests>-->
36  <help>
37
38.. class:: warningmark
39
40The input dataset needs to be sequences.
41
42-----
43
44**Syntax**
45
46This application plots GC content over a sequence. It is intended for large sequences such as complete chromosomes or large genomic contigs, although interesting results can also be obtained from shorter sequences. You can view the original documentation here_.    
47
48    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/isochore.html
49
50- Both **Window size** and **Shift increment** are intergers.
51
52-----
53
54**Example**
55
56- Input sequences::
57
58    >hg18_dna range=chrX:151073054-151073376 5'pad=0 3'pad=0 revComp=FALSE strand=? repeatMasking=none
59    TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA
60    GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTGTCTTTATGCCTCAGATT
61    TGGAGTGCTCAGAGCCTCTGCAGCAAAGATTTGGCATGTGTCCTAGGCCT
62    GCTCAGAGCAGCAAATCCCACCCTCTTGGAGAATGAGACTCATAGAGGGA
63    CAGCTCCCTCCTCAGAGGCTTCTCTAATGGGACTCCAAAGAGCAAACACT
64    CAGCCCCATGAGGACTGGCCAGGCCAAGTGGTGTGTGGGAACAGGGAGCA
65    GCGGTTTCCAAGAGGATACAGTA
66
67- Output data file::
68
69    Position	Percent G+C 1 .. 323
70    80	0.422
71    112	0.460
72    144	0.509
73    176	0.534
74    208	0.553
75    240	0.553
76
77- Output graphics file:
78
79.. image:: ./static/emboss_icons/isochore.png
80
81------
82
83**Citation**
84
85If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
86
87  </help>
88</tool>