/tools/fasta_tools/fasta_to_tabular.xml
https://bitbucket.org/cistrome/cistrome-harvard/ · XML · 128 lines · 101 code · 27 blank · 0 comment · 0 complexity · cb3c7ce13cb384fa3ee199fa173334f8 MD5 · raw file
- <tool id="fasta2tab" name="FASTA-to-Tabular" version="1.1.0">
- <description>converter</description>
- <command interpreter="python">fasta_to_tabular.py $input $output $keep_first $descr_columns</command>
- <inputs>
- <param name="input" type="data" format="fasta" label="Convert these sequences"/>
- <param name="descr_columns" type="integer" size="2" value="1" label="How many columns to divide title string into?" help="Typically 2 to take the ID (first word) and decription (rest) as two columns, or 1 to give a single column">
- <validator type="in_range" min="1" />
- </param>
- <param name="keep_first" type="integer" size="5" value="0" label="How many title characters to keep?" help="Applies only to the first column taken from the title string ('0' = keep the whole thing), useful when your sequence identifiers are all the same length.">
- <validator type="in_range" min="0" />
- </param>
- </inputs>
- <outputs>
- <data name="output" format="tabular"/>
- </outputs>
- <tests>
- <test>
- <param name="input" value="454.fasta" />
- <param name="descr_columns" value="1"/>
- <param name="keep_first" value="0"/>
- <output name="output" file="fasta_to_tabular_out1.tabular" />
- </test>
-
- <test>
- <param name="input" value="4.fasta" />
- <param name="descr_columns" value="1"/>
- <param name="keep_first" value="0"/>
- <output name="output" file="fasta_to_tabular_out2.tabular" />
- </test>
-
- <test>
- <param name="input" value="454.fasta" />
- <param name="descr_columns" value="1"/>
- <param name="keep_first" value="14"/>
- <output name="output" file="fasta_to_tabular_out3.tabular" />
- </test>
- <test>
- <param name="input" value="454.fasta" />
- <param name="descr_columns" value="2"/>
- <param name="keep_first" value="0"/>
- <output name="output" file="fasta_to_tabular_out4.tabular" />
- </test>
- <test>
- <param name="input" value="454.fasta" />
- <param name="descr_columns" value="5"/>
- <param name="keep_first" value="0"/>
- <output name="output" file="fasta_to_tabular_out5.tabular" />
- </test>
- <test>
- <param name="input" value="454.fasta" />
- <param name="descr_columns" value="5"/>
- <param name="keep_first" value="10"/>
- <output name="output" file="fasta_to_tabular_out6.tabular" />
- </test>
- </tests>
- <help>
-
- **What it does**
- This tool converts FASTA formatted sequences to TAB-delimited format.
- Many tools consider the first word of the FASTA ">" title line to be an identifier, and any remaining text to be a free form description.
- It is therefore useful to split this text into two columns in Galaxy (identifier and any description) by setting **How many columns to divide title string into?** to **2**.
- In some cases the description can be usefully broken up into more columns -- see the examples .
- The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry.
- With the introduction of the **How many columns to divide title string into?** option this setting is of limited use, but does still allow you to truncate the identifier.
- -----
- **Example**
- Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run::
- >EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_
- TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG
- TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
- >EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_
- AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAA
- Running this tool with the default settings will produce this (2 column output):
- ========================================================================== =======================================
- EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG
- EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA
- ========================================================================== =======================================
- Having the full title line (the FASTA ">" line text) as a column is not always ideal.
- The **How many characters to keep?** option is useful if your identifiers are all the same length.
- In this example the identifier is 14 characters, so setting **How many characters to keep?** to **14** (and leaving **How many columns to divide title string into?** as the default, **1**) will produce this (2 column output):
- ============== =======================================
- EYKX4VC02EQLO5 TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG
- EYKX4VC02D4GS2 AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA
- ============== =======================================
- If however your FASTA file has identifiers of variable length, it is better to split the text into at least two columns.
- Running this tool with **How many columns to divide title string into?** to **2** will produce this (3 column output):
- ============== =========================================================== =======================================
- EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG
- EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA
- ============== =========================================================== =======================================
- Running this tool with **How many columns to divide title string into?** to **5** will produce this (5 column output):
- ============== ========== ============ ======== ========================== =======================================
- EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG
- EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA
- ============== ========== ============ ======== ========================== =======================================
- Running this tool with **How many columns to divide title string into?** to **5** and **How many characters to keep?** to **10** will produce this (5 column output).
- Notice that only the first column is truncated to 10 characters -- and be careful not to trim your sequence names too much (generally they should be unique):
- ========== ========== ============ ======== ========================== =======================================
- EYKX4VC02E length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG
- EYKX4VC02D length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA
- ========== ========== ============ ======== ========================== =======================================
- Note the sequences have been truncated for display purposes in the above tables.
- </help>
- </tool>