/tools/fasta_tools/fasta_to_tabular.xml
XML | 128 lines | 101 code | 27 blank | 0 comment | 0 complexity | cb3c7ce13cb384fa3ee199fa173334f8 MD5 | raw file
1<tool id="fasta2tab" name="FASTA-to-Tabular" version="1.1.0"> 2 <description>converter</description> 3 <command interpreter="python">fasta_to_tabular.py $input $output $keep_first $descr_columns</command> 4 <inputs> 5 <param name="input" type="data" format="fasta" label="Convert these sequences"/> 6 <param name="descr_columns" type="integer" size="2" value="1" label="How many columns to divide title string into?" help="Typically 2 to take the ID (first word) and decription (rest) as two columns, or 1 to give a single column"> 7 <validator type="in_range" min="1" /> 8 </param> 9 <param name="keep_first" type="integer" size="5" value="0" label="How many title characters to keep?" help="Applies only to the first column taken from the title string ('0' = keep the whole thing), useful when your sequence identifiers are all the same length."> 10 <validator type="in_range" min="0" /> 11 </param> 12 </inputs> 13 <outputs> 14 <data name="output" format="tabular"/> 15 </outputs> 16 <tests> 17 <test> 18 <param name="input" value="454.fasta" /> 19 <param name="descr_columns" value="1"/> 20 <param name="keep_first" value="0"/> 21 <output name="output" file="fasta_to_tabular_out1.tabular" /> 22 </test> 23 24 <test> 25 <param name="input" value="4.fasta" /> 26 <param name="descr_columns" value="1"/> 27 <param name="keep_first" value="0"/> 28 <output name="output" file="fasta_to_tabular_out2.tabular" /> 29 </test> 30 31 <test> 32 <param name="input" value="454.fasta" /> 33 <param name="descr_columns" value="1"/> 34 <param name="keep_first" value="14"/> 35 <output name="output" file="fasta_to_tabular_out3.tabular" /> 36 </test> 37 38 <test> 39 <param name="input" value="454.fasta" /> 40 <param name="descr_columns" value="2"/> 41 <param name="keep_first" value="0"/> 42 <output name="output" file="fasta_to_tabular_out4.tabular" /> 43 </test> 44 45 <test> 46 <param name="input" value="454.fasta" /> 47 <param name="descr_columns" value="5"/> 48 <param name="keep_first" value="0"/> 49 <output name="output" file="fasta_to_tabular_out5.tabular" /> 50 </test> 51 52 <test> 53 <param name="input" value="454.fasta" /> 54 <param name="descr_columns" value="5"/> 55 <param name="keep_first" value="10"/> 56 <output name="output" file="fasta_to_tabular_out6.tabular" /> 57 </test> 58 59 </tests> 60 <help> 61 62**What it does** 63 64This tool converts FASTA formatted sequences to TAB-delimited format. 65 66Many tools consider the first word of the FASTA ">" title line to be an identifier, and any remaining text to be a free form description. 67It is therefore useful to split this text into two columns in Galaxy (identifier and any description) by setting **How many columns to divide title string into?** to **2**. 68In some cases the description can be usefully broken up into more columns -- see the examples . 69 70The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. 71With the introduction of the **How many columns to divide title string into?** option this setting is of limited use, but does still allow you to truncate the identifier. 72 73----- 74 75**Example** 76 77Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run:: 78 79 >EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ 80 TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG 81 TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG 82 >EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ 83 AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAA 84 85Running this tool with the default settings will produce this (2 column output): 86 87========================================================================== ======================================= 88EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG 89EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA 90========================================================================== ======================================= 91 92Having the full title line (the FASTA ">" line text) as a column is not always ideal. 93 94The **How many characters to keep?** option is useful if your identifiers are all the same length. 95In this example the identifier is 14 characters, so setting **How many characters to keep?** to **14** (and leaving **How many columns to divide title string into?** as the default, **1**) will produce this (2 column output): 96 97============== ======================================= 98EYKX4VC02EQLO5 TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG 99EYKX4VC02D4GS2 AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA 100============== ======================================= 101 102If however your FASTA file has identifiers of variable length, it is better to split the text into at least two columns. 103Running this tool with **How many columns to divide title string into?** to **2** will produce this (3 column output): 104 105============== =========================================================== ======================================= 106EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG 107EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA 108============== =========================================================== ======================================= 109 110Running this tool with **How many columns to divide title string into?** to **5** will produce this (5 column output): 111 112============== ========== ============ ======== ========================== ======================================= 113EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG 114EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA 115============== ========== ============ ======== ========================== ======================================= 116 117Running this tool with **How many columns to divide title string into?** to **5** and **How many characters to keep?** to **10** will produce this (5 column output). 118Notice that only the first column is truncated to 10 characters -- and be careful not to trim your sequence names too much (generally they should be unique): 119 120========== ========== ============ ======== ========================== ======================================= 121EYKX4VC02E length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG 122EYKX4VC02D length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA 123========== ========== ============ ======== ========================== ======================================= 124 125Note the sequences have been truncated for display purposes in the above tables. 126 127 </help> 128</tool>