PageRenderTime 18ms CodeModel.GetById 2ms app.highlight 9ms RepoModel.GetById 1ms app.codeStats 0ms

/tools/sr_mapping/lastz_wrapper.xml

https://bitbucket.org/cistrome/cistrome-harvard/
XML | 524 lines | 450 code | 44 blank | 30 comment | 0 complexity | 6b37a6f721825f405383f25230ff6c64 MD5 | raw file
  1<tool id="lastz_wrapper_2" name="Lastz" version="1.2.2">
  2    <description> map short reads against reference sequence</description>
  3    <command interpreter="python">lastz_wrapper.py
  4      #if $seq_name.how_to_name=="yes":
  5        --ref_name=$seq_name.ref_name 
  6      #end if
  7      --ref_source=$source.ref_source
  8      --source_select=$params.source_select
  9      --out_format=$out_format
 10      --input2=$input2 
 11      #if $source.ref_source=="history":
 12        --input1=$source.input1
 13        --ref_sequences=$input1.metadata.sequences 
 14      #else:
 15        --input1="${ filter( lambda x: str( x[0] ) == str( $source.input1_2bit ), $__app__.tool_data_tables[ 'lastz_seqs' ].get_fields() )[0][-1] }"
 16        --ref_sequences="None" 
 17      #end if
 18      #if $params.source_select=="pre_set":
 19        --pre_set_options=${params.pre_set_options}
 20      #else:
 21        --strand=$params.strand
 22        --seed=$params.seed
 23        --gfextend=$params.gfextend
 24        --chain=$params.chain
 25        --transition="$params.transition"
 26        --O=$params.O
 27        --E=$params.E
 28        --X=$params.X
 29        --Y=$params.Y
 30        --K=$params.K
 31        --L=$params.L
 32        --entropy=$params.entropy 
 33      #end if
 34      --identity_min=$min_ident
 35      --identity_max=$max_ident
 36      --coverage=$min_cvrg
 37      --output=$output1
 38      --unmask=$unmask
 39      --lastzSeqsFileDir=${GALAXY_DATA_INDEX_DIR}
 40    </command>
 41    <inputs>
 42        <param name="input2" format="fasta" type="data" label="Align sequencing reads in" />
 43        <conditional name="source">
 44            <param name="ref_source" type="select" label="Against reference sequences that are">
 45                <option value="cached">locally cached</option>
 46                <option value="history">in your history</option>
 47            </param>
 48            <when value="cached">
 49                <param name="input1_2bit" type="select" label="Using reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
 50                    <options from_data_table="lastz_seqs" />
 51                </param>
 52            </when>
 53            <when value="history">
 54                <param name="input1" type="data" format="fasta" label="Select a reference dataset" />
 55            </when>
 56        </conditional>
 57        <param name="out_format" type="select" label="Output format">
 58            <option value="sam">SAM</option>
 59            <option value="diffs">Polymorphisms</option>
 60            <option value="tabular">Tabular</option>
 61        </param>
 62        <conditional name="params">
 63            <param name="source_select" type="select" label="Lastz settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full List">
 64                <option value="pre_set">Commonly used</option>
 65                <option value="full">Full Parameter List</option>
 66            </param>
 67            <when value="pre_set">
 68                <param name="pre_set_options" type="select" label="Select mapping mode">
 69                    <option value="yasra98">Roche-454 98% identity</option>
 70                    <option value="yasra95">Roche-454 95% identity</option>
 71                    <option value="yasra90">Roche-454 90% identity</option>
 72                    <option value="yasra85">Roche-454 85% identity</option>
 73                    <option value="yasra75">Roche-454 75% identity</option>
 74                    <option value="yasra95short">Illumina 95% identity</option>
 75                    <option value="yasra85short">Illumina 85% identity</option>
 76                </param>
 77            </when>
 78            <when value="full">
 79                <param name="strand" type="select" label="Which strand to search?">
 80                    <option value="both">Both</option>
 81                    <option value="plus">Search forward strand only (the one in the reference)</option>
 82                    <option value="minus">Search the reverse complement strand only (opposite of the reference)</option>
 83                </param>
 84                <param name="seed" type="select" label="Select seeding settings" help="allows you set word size and number of mismatches">
 85                    <option value="12of19">Seed hits require a 19 bp word with matches in 12 specific positions</option>
 86                    <option value="14of22">Seed hits require a 22 bp word with matches in 14 specific positions</option>
 87                </param>
 88                <param name="transition" type="select" label="Select transition settings" help="affects the number of allowed transition substitutions">
 89                    <option value="transition">Allow one transition in each seed hit</option>
 90                    <option value="transition=2">Allow two transitions in a seed hit </option>
 91                    <option value="notransition">Don't allow any transitions in seed hits</option>
 92                </param>
 93                <param name="gfextend" type="select" label="Perform gap-free extension of seed hits to HSPs (high scoring segment pairs)?">
 94                    <option value="nogfextend">No</option>
 95                    <option value="gfextend">Yes</option>
 96                </param>
 97                <param name="chain" type="select" label="Perform chaining of HSPs?">
 98                    <option value="nochain">No</option>
 99                    <option value="chain">Yes</option>
100                </param>
101                <param name="O" type="integer" size="5" value="400" label="Gap opening penalty"/>
102                <param name="E" type="integer" size="5" value="30" label="Gap extension penalty"/>
103                <param name="X" type="integer" size="5" value="910" label="X-drop threshold"/>
104                <param name="Y" type="integer" size="5" value="9370" label="Y-drop threshold"/>
105                <param name="K" type="integer" size="5" value="3000" label="Set the threshold for HSPs (ungapped extensions scoring lower are discarded)"/>
106                <param name="L" type="integer" size="5" value="3000" label="Set the threshold for gapped alignments (gapped extensions scoring lower are discarded)"/>
107                <param name="entropy" type="select" label="Involve entropy when filtering HSPs?">
108                    <option value="noentropy">No</option>
109                    <option value="entropy">Yes</option>
110                </param>
111            </when>   
112        </conditional>
113        <conditional name="seq_name">
114            <param name="how_to_name" type="select" label="Do you want to modify the reference name?">
115                <option value="no">No</option>
116                <option value="yes">Yes</option>
117            </param>
118            <when value="yes">
119                <param name="ref_name" type="text" size="25" value="Type sequence name here" label="Enter name for the Reference sequence"/>
120            </when>
121            <when value="no" />
122        </conditional>
123        <param name="min_ident" type="integer" size="3" value="0" label="Do not report matches below this identity (%)"/>
124        <param name="max_ident" type="integer" size="3" value="100" label="Do not report matches above this identity (%)"/>
125        <param name="min_cvrg" type="integer" size="3" value="0" label="Do not report matches that cover less than this percentage of each read"/>
126        <param name="unmask" type="select" label="Convert lowercase bases to uppercase">
127            <option value="yes">Yes</option>
128            <option value="no">No</option>
129        </param>
130    </inputs>
131    <outputs>
132        <data format="tabular" name="output1" label="${tool.name} on ${on_string}: mapped reads">
133            <change_format>
134                <when input="out_format" value="sam" format="sam" />
135            </change_format>
136        </data>
137    </outputs>
138    <requirements>
139        <requirement type="package">lastz</requirement>
140    </requirements>
141    <tests>
142        <test>
143            <!--
144            Lastz command:
145            lastz phiX.2bit/phiX174[nickname=Ref] test-data/b1.fasta +nogfextend +nochain +gapped +strand=both +seed=12of19 +transition O=400 E=30 X=910 Y=9370 K=3000 L=3000 +noentropy +ambiguousn +nolaj +identity=0..100 +coverage=0 +format=sam- > lastz_wrapper_out2.sam 
146            You need to point to phiX.2bit somewhere on your system. b1.fasta is located in galaxy's test-data.  You will have to replace all the pluses before the
147            commands with 2 dashes, as double-dash can't appear in an XML comment.
148            -->
149            <param name="input2" value="b1.fasta" ftype="fasta" />
150            <param name="ref_source" value="cached" />
151            <!-- this is the backwards-compatible "unique value" for this file, not an actual path -->
152            <param name="input1_2bit" value="/galaxy/data/phiX/seq/phiX.2bit" />
153            <param name="out_format" value="sam" />
154            <param name="source_select" value="full" />
155            <param name="strand" value="both" />
156            <param name="seed" value="12of19" />
157            <param name="transition" value="transition" />
158            <param name="gfextend" value="nogfextend" />
159            <param name="chain" value="nochain" />
160            <param name="O" value="400" />
161            <param name="E" value="30" />
162            <param name="X" value="910" />
163            <param name="Y" value="9370" />
164            <param name="K" value="3000" />
165            <param name="L" value="3000" />
166            <param name="entropy" value="noentropy" />
167            <!--
168            how_to_name is not the default. It is changed to modify 
169            input1_2bit by adding the ref_name as a nickname
170            -->
171            <param name="how_to_name" value="yes" />
172            <param name="ref_name" value="Ref" />
173            <param name="min_ident" value="0" />
174            <param name="max_ident" value="100" />
175            <param name="min_cvrg" value="0" />
176            <param name="unmask" value="yes" />
177            <output name="output1" file="lastz_wrapper_out2.sam" />
178        </test>
179        <test>
180            <!--
181            Lastz command:
182            lastz test-data/phiX.fasta test-data/b1.fasta[fullnames] +yasra95short +ambiguousn +nolaj +identity=0..100 +coverage=0 +format=diffs > lastz_wrapper_out3.tabular 
183            phiX.fasta and b1.fasta are located in galaxy's test-data.  You will have to replace all the pluses before the commands with 2 dashes, 
184            as double-dash can't appear in an XML comment.
185            -->
186            <param name="input2" value="b1.fasta" ftype="fasta" />
187            <param name="ref_source" value="history" />
188            <param name="input1" value="phiX.fasta" ftype="fasta" />
189            <param name="out_format" value="diffs" />
190            <param name="source_select" value="pre_set" />
191            <param name="pre_set_options" value="yasra95short" />
192            <param name="how_to_name" value="no" />
193            <param name="min_ident" value="0" />
194            <param name="max_ident" value="100" />
195            <param name="min_cvrg" value="0" />
196            <param name="unmask" value="yes" />
197            <output name="output1" file="lastz_wrapper_out3.tabular" />
198        </test>
199        <test>
200            <!--
201            Lastz command: first you will need to split the file phiX_split.fasta into two files, 
202            phiX1.fasta and phiX2.fasta, each with 1 sequence (phiX1 and phiX2, respectively). Then:
203            lastz phiX1.fasta test-data/b1.fasta *yasra95short *ambiguousn *nolaj *identity=0..100 *coverage=0 *format=general-:score,name1,strand1,size1,start1,zstart1,end1,length1,text1,name2,strand2,size2,start2,zstart2,end2,start2+,zstart2+,end2+,length2,text2,diff,cigar,identity,coverage,gaprate,diagonal,shingle > lastz_wrapper_out4.tabular 
204            lastz phiX2.fasta test-data/b1.fasta *yasra95short *ambiguousn *nolaj *identity=0..100 *coverage=0 *format=general-:score,name1,strand1,size1,start1,zstart1,end1,length1,text1,name2,strand2,size2,start2,zstart2,end2,start2+,zstart2+,end2+,length2,text2,diff,cigar,identity,coverage,gaprate,diagonal,shingle >> lastz_wrapper_out4.tabular 
205            You need to point to phiX1.fasta and phiX2.fasta somewhere on your system. 
206            phiX_split.fasta and b1.fasta are located in galaxy's test-data 
207            You will have to replace all the asterisks before the commands with 2 dashes, 
208            as double-dash can't appear in an XML comment 
209
210            NOTE: since the input file include more than 1 sequence, the output must be sorted in 
211            order for functional test to pass.  This is done using the sort="True" attribute on the output.
212            -->
213            <param name="input2" value="b1.fasta" ftype="fasta" />
214            <param name="ref_source" value="history" />
215            <param name="input1" value="phiX_split.fasta" ftype="fasta"  />
216            <param name="out_format" value="tabular" />
217            <param name="source_select" value="pre_set" />
218            <param name="pre_set_options" value="yasra95short" />
219            <param name="how_to_name" value="no" />
220            <param name="min_ident" value="0" />
221            <param name="max_ident" value="100" />
222            <param name="min_cvrg" value="0" />
223            <param name="unmask" value="yes" />
224            <output name="output1" file="lastz_wrapper_out4.tabular" sort="True" />
225        </test>
226    </tests>
227    <help>
228        
229**What it does**
230        
231**LASTZ** is a high performance pairwise sequence aligner derived from BLASTZ. It is written by Bob Harris in Webb Miller's laboratory at Penn State University. Special scoring sets were derived to improve runtime performance and quality. This Galaxy version of LASTZ is geared towards aligning short (Illumina/Solexa, AB/SOLiD) and medium (Roche/454) reads against a reference sequence. There is excellent, extensive documentation on LASTZ available here_.
232
233 .. _here: http://www.bx.psu.edu/miller_lab/dist/README.lastz-1.02.00/README.lastz-1.02.00.html
234 
235------
236
237**Input formats**
238
239LASTZ accepts reference and reads in FASTA format. However, because Galaxy supports implicit format conversion the tool will recognize fastq and other method specific formats.
240
241------
242
243**Outputs**
244
245LASTZ generates one output. Depending on the choice you make in the *Select output format* drop-down, LASTZ will produce a SAM file showing sequence alignments, a list of differences between the reads and reference (Polymorphisms), or a general table with one line per alignment block (Tabular). Examples of these outputs are shown below.
246
247**SAM output**
248
249SAM has 12 columns::
250
251                                   1     2     3         4   5    6  7         8     9                                    10                                     11  12
252  ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
253  HWI-EAS91_1_30788AAXX:1:2:1670:915    99  chr9  58119878  60  36M  =  58120234   392  GACCCCTACCCCACCGTGCTCTGGATCTCAGTGTTT   IIIIIIIIIIIIIIIIEIIIIIII7IIIIIIIIIII  XT:A:U  NM:i:0  SM:i:37  AM:i:37  X0:i:1  X1:i:0  XM:i:0  XO:i:0  XG:i:0  MD:Z:36
254  HWI-EAS91_1_30788AAXX:1:2:1670:915   147  chr9  58120234  60  36M  =  58119878  -392  ATGAGTCGAATTCTATTTTCCAAACTGTTAACAAAA   IFIIDI;IIICIIIIIIIIIIIIIIIIIIIIIIIII  XT:A:U  NM:i:0  SM:i:37  AM:i:37  X0:i:1  X1:i:0  XM:i:0  XO:i:0  XG:i:0  MD:Z:36
255
256
257where::
258
259     Column  Description
260  ---------  ---------------------------------------------------------------------   
261   1. QNAME  Query (pair) NAME
262   2. FLAG   bitwise FLAG
263   3. RNAME  Reference sequence NAME
264   4. POS    1-based leftmost POSition/coordinate of clipped sequence
265   5. MAPQ   MAPping Quality (Phred-scaled)
266   6. CIGAR  extended CIGAR string
267   7. MRNM   Mate Reference sequence NaMe ('=' if same as RNAME)
268   8. MPOS   1-based Mate POSition
269   9. ISIZE  Inferred insert SIZE
270  10. SEQ    query SEQuence on the same strand as the reference
271  11. QUAL   query QUALity (ASCII-33 gives the Phred base quality)
272  12. OPT    variable OPTional fields in the format TAG:VTYPE:VALUE, tab-separated
273  
274The flags are as follows::
275
276    Flag  Description
277  ------  -------------------------------------
278  0x0001  the read is paired in sequencing
279  0x0002  the read is mapped in a proper pair
280  0x0004  the query sequence itself is unmapped
281  0x0008  the mate is unmapped
282  0x0010  strand of the query (1 for reverse)
283  0x0020  strand of the mate
284  0x0040  the read is the first read in a pair
285  0x0080  the read is the second read in a pair
286  0x0100  the alignment is not primary
287
288**Polymorphism (SNP or differences) output**
289
290Polymorphism output contains 14 columns::
291
292     1     2     3  4     5                                   6   7   8  9  10  11 12                                   13                                    14
293  --------------------------------------------------------------------------------------------------------------------------------------------------------------
294  chrM  2490  2491  +  5386  HWI-EAS91_1_306UPAAXX:6:1:486:822   10  11  -  36  C  A  ACCTGTTTTACAGACACCTAAAGCTACATCGTCAAC  ACCTGTTTTAAAGACACCTAAAGCTACATCGTCAAC
295  chrM  2173  2174  +  5386  HWI-EAS91_1_306UPAAXX:6:1:259:1389  26  27  +  36  G  T  GCGTACTTATTCGCCACCATGATTATGACCAGTGTT  GCGTACTTATTCGCCACCATGATTATTACCAGTGTT
296
297where::
298
299  1. (chrM)   - Reference sequence id
300  2. (2490)   - Start position of the difference in the reference
301  3. (2491)   - End position of the difference in the reference
302  4. (+)      - Strand of the reference (always plus)
303  5. (5386)   - Length of the reference sequence
304  6. (HWI...) - read id
305  7. (10)     - Start position of the difference in the read
306  8. (11)     - End position of the difference in the read
307  9. (+)      - Strand of the read
308 10. (36)     - Length of the read
309 11. (C)      - Nucleotide in the reference
310 12. (A)      - Nucleotide in the read
311 13. (ACC...) - Reference side os the alignment
312 14. (ACC...) - Read side of the alignment
313 
314**Tabular output**
315
316Tabular output is a tab-separated format with 30 columns::
317
318   1        2  3     4     5     6     7   8                 9              10  11   12   13   14   15   16   17   18  19                20                21   22     23      24      25    26    27    28    29  30
319  -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
320  14  PHIX174  +  5386  4648  4647  4661  14  ATTTTCGTGATATT    EYKX4VC01BV8HS  +   204  154  153  167  154  153  167  14  ATTTTCGTGATATT    ..............    14M  14/14  100.0%  14/204  6.9%  0/14  0.0%  4494  NA
321  16  PHIX174  +  5386  3363  3362  3378  16  GACGCCGGATTTGAGA  EYKX4VC01AWJ88  -   259   36   35   51  209  208  224  16  GACGCCGGATTTGAGA  ................  16M  16/16  100.0%  16/259  6.2%  0/16  0.0%  3327  NA
322
323The following columns are present::
324
325             Field  Meaning
326  ----------------  -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
327   1.        score  Score of the alignment block. The scale and meaning of this number will vary, depending on the final stage performed and other command-line options.
328   2.        name1  Name of the target sequence.
329   3.      strand1  Target sequence strand, either "+" or "?".
330   4.        size1  Size of the entire target sequence.
331   5.       start1  Starting position of the alignment block in the target, origin-one.
332   6.      zstart1  Starting position of the alignment block in the target, origin-zero.
333   7.         end1  Ending position of the alignment block in the target, expressed either as origin-one closed or origin-zero half-open (the ending value is the same in both systems).
334   8.      length1  Length of the alignment block in the target (excluding gaps).
335   9.        text1  Aligned characters in the target, including gap characters.
336  10.        name2  Name of the query sequence.
337  11.      strand2  Query sequence strand, either "+" or "?".
338  12.        size2  Size of the entire query sequence.
339  13.       start2  Starting position of the alignment block in the query, origin-one.
340  14.      zstart2  Starting position of the alignment block in the query, origin-zero.
341  15.         end2  Ending position of the alignment block in the query, expressed either as origin-one closed or origin-zero half-open (the ending value is the same in both systems).
342  16.      start2+  Starting position of the alignment block in the query, counting along the query sequence's positive strand (regardless of which query strand was aligned), origin-one. Note that if strand2 is "?", then this is the other end of the block from start2.
343  17.     zstart2+  Starting position of the alignment block in the query, counting along the query sequence's positive strand (regardless of which query strand was aligned), origin-zero. Note that if strand2 is "?", then this is the other end of the block from zstart2.
344  18.        end2+  Ending position of the alignment block in the query, counting along the query sequence's positive strand (regardless of which query strand was aligned), expressed either as origin-one closed or origin-zero half-open (the ending value is the same in both systems). Note that if strand2 is "?", then this is the other end of the block from end2.
345  19.      length2  Length of the alignment block in the query (excluding gaps).
346  20.        text2  Aligned characters in the query, including gap characters.
347  21.         diff  Differences between what would be written for text1 and text2. Matches are written as . (period), transitions as : (colon), transversions as X, and gaps as - (hyphen).
348  22.        cigar  A CIGAR-like representation of the alignment's path through the Dynamic Programming matrix. This is the short representation, without spaces, described in the Ensembl CIGAR specification.
349  23./24. identity  Fraction of aligned bases in the block that are matches (see Identity). This is written as two fields. The first field is a fraction, written as &lt;n&gt;/&lt;d&gt;. The second field contains the same value, computed as a percentage.
350  25./26. coverage  Fraction of the entire input sequence (target or query, whichever is shorter) that is covered by the alignment block (see Coverage). This is written as two fields. The first field is a fraction, written as &lt;n&gt;/&lt;d&gt;. The second field contains the same value, computed as a percentage.
351  27./28.  gaprate  Rate of gaps (also called indels) in the alignment block. This is written as two fields. The first field is a fraction, written as &lt;n&gt;/&lt;d&gt;, with the numerator being the number of alignment columns containing gaps and the denominator being the number without gaps. The second field contains the same value, computed as a percentage.
352  29.     diagonal  The diagonal of the start of the alignment block in the dynamic programming matrix, expressed as an identifying number start1-start2.
353  30.      shingle  A measurement of the shingle overlap between the target and the query. This is intended for the case where both the target and query are relatively short, and their ends are expected to overlap.  
354
355-------
356
357**LASTZ Settings**
358
359There are two setting modes: (1) **Commonly used settings** and (2) **Full Parameter List**.
360
361**Commonly used settings**
362
363There are seven modes::
364
365  Illumina-Solexa/AB-SOLiD 95% identity
366  Illumina-Solexa/AB-SOLiD 85% identity
367  Roche-454 98% identity
368  Roche-454 95% identity
369  Roche-454 90% identity
370  Roche-454 85% identity
371  Roche-454 75% identity
372
373When deciding which one to use, consider the following: a 36 bp read with two differences will be 34/36 = 94% identical to the reference.  
374
375**Full Parameter List**
376
377This mode gives you fuller control over lastz. The description of these and other parameters is found at the end of this page. Note that not all parameters are included in this interface. If you would like to make additional options available through Galaxy, e-mail us at galaxy-bugs@bx.psu.edu.
378
379------
380
381**Do you want to modify the reference name?**
382
383This option allows you to set the name of the reference sequence manually. This is helpful when, for example, you would like to make the reference name compatible with the UCSC naming conventions to be able to display your lastz results as a custom track at the UCSC Genome Browser.
384
385------
386
387**LASTZ parameter list**
388
389This is an exhaustive list of LASTZ options. Once again, please note that not all options are included in this interface. If you would like to make additional options available through Galaxy, e-mail us at galaxy-bugs@bx.psu.edu::
390
391  target[[s..e]][-]       spec/file containing target sequence (fasta or nib)
392                          [s..e] defines a subrange of the file
393                          - indicates reverse-complement
394                          (use --help=files for more details)
395  query[[s..e]][-]        spec/file containing query sequences (fasta or nib)
396                          if absent, queries come from stdin (unless they
397                          aren't needed, as for --self or --tableonly)
398                          (use --help=files for more details)
399  --self                  the target sequence is also the query
400  --quantum               the query sequence contains quantum DNA
401  --seed=match&lt;length&gt;    use a word with no gaps instead of a seed pattern
402  --seed=half&lt;length&gt;     use space-free half-weight word instead of seed pattern
403  --match=&lt;reward&gt;[,&lt;penalty&gt;]   set the score values for a match (+&lt;reward&gt;)
404                          and mismatch (-&lt;penalty&gt;)
405  --[no]trans[ition][=2]         allow one or two transitions in a seed hit
406                          (by default a transition is allowed)
407  --word=&lt;bits&gt;           set max bits for word hash;  use this to trade time for
408                          memory, eliminating thrashing for heavy seeds
409                          (default is 28 bits)
410  --[no]filter=[&lt;T&gt;:]&lt;M&gt;     filter half-weight seed hits, requiring at least M
411                          matches and allowing no more than T transversions
412                          (default is no filtering)
413  --notwins               require just one seed hit
414  --twins=[&lt;min&gt;:]&lt;maxgap&gt;   require two nearby seed hits on the same diagonal
415                          (default is twins aren't required)
416  --notwins               allow single, isolated seeds
417  --[no]recoverseeds      avoid losing seeds in hash collisions. Cannot be used with --twins
418  --seedqueue=&lt;entries&gt;   set number of entries in seed hit queue
419                          (default is 262144)
420  --anchors=&lt;file&gt;        read anchors from a file, instead of discovering anchors
421                          via seeding
422  --recoverhits           recover hash-collision seed hits
423                          (default is not to recover seed hits)
424  --step=&lt;length&gt;         set step length (default is 1)
425  --maxwordcount=&lt;limit&gt;  words occurring more often than &lt;limit&gt; in the target
426                          are not eligible for seeds
427  --strand=both           search both strands
428  --strand=plus           search + strand only (matching strand of query spec)
429  --strand=minus          search - strand only (opposite strand of query spec)
430                          (by default both strands are searched)
431  --ambiguousn            treat N as an ambiguous nucleotide
432                          (by default N is treated as a sequence splicing character)
433  --[no]gfextend          perform gap-free extension of seed hits to HSPs
434                          (by default no extension is performed)
435  --[no]chain             perform chaining
436  --chain=&lt;diag,anti&gt;     perform chaining with given penalties for diagonal and
437                          anti-diagonal
438                          (by default no chaining is performed)
439  --[no]gapped            perform gapped alignment (instead of gap-free)
440                          (by default gapped alignment is performed)
441  --score[s]=&lt;file&gt;         read substitution scores from a file
442                          (default is HOXD70)
443  --unitscore[s]          scores are +1/-1 for match/mismatch
444  --gap=&lt;[open,]extend&gt;   set gap open and extend penalties (default is 400,30)
445  --xdrop=&lt;score&gt;         set x-drop threshold (default is 10*sub[A][A])
446  --ydrop=&lt;score&gt;         set y-drop threshold (default is open+300extend)
447  --infer[=&lt;control&gt;]     infer scores from the sequences, then use them
448  --inferonly[=&lt;control&gt;]   infer scores, but don't use them (requires --infscores)
449                          all inference options are read from the control file
450  --infscores[=&lt;file&gt;]    write inferred scores to a file
451  --hspthresh=&lt;score&gt;     set threshold for high scoring pairs (default is 3000)
452                          ungapped extensions scoring lower are discarded
453                          &lt;score&gt; can also be a percentage or base count
454  --entropy               adjust for entropy when qualifying HSPs in the x-drop extension 
455                          method
456  --noentropy             don't adjust for entropy when qualifying HSPs
457  --exact=&lt;length&gt;        set threshold for exact matches
458                          if specified, exact matches are found rather than high
459                          scoring pairs (replaces --hspthresh)
460  --inner=&lt;score&gt;         set threshold for HSPs during interpolation
461                          (default is no interpolation)
462  --gappedthresh=&lt;score&gt;  set threshold for gapped alignments
463                          gapped extensions scoring lower are discarded
464                          &lt;score&gt; can also be a percentage or base count
465                          (default is to use same value as --hspthresh)
466  --ball=&lt;score&gt;          set minimum score required of words 'in' a quantum ball
467  --[no]entropy           involve entropy in filtering high scoring pairs
468                          (default is "entropy")
469  --[no]mirror            report/use mirror image of all gap-free alignments
470                          (default is "mirror" for self-alignments only)
471  --traceback=&lt;bytes&gt;     space for trace-back information
472                          (default is 80.0M)
473  --masking=&lt;count&gt;       mask any position in target hit this many times
474                          zero indicates no masking
475                          (default is no masking)
476  --targetcapsule=&lt;capsule_file&gt;   the target seed word position table and seed
477                          (as well as the target sequence)are read from specified file
478  --segments=&lt;segment_file&gt;   read segments from a file, instead of discovering
479                          them via seeding. Replaces other seeding or gap-free extension
480                          options
481  --[no]census[=&lt;file&gt;]     count/report how many times each target base aligns
482                          (default is to not report census)
483  --identity=&lt;min&gt;[..&lt;max&gt;]   filter alignments by percent identity
484                          0&lt;=min&lt;=max&lt;=100;  blocks (or HSPs) outside min..max
485                          are discarded
486                          (default is no identity filtering)
487  --coverage=&lt;min&gt;[..&lt;max&gt;]   filter alignments by percentage pf query covered
488                          0&lt;=min&lt;=max&lt;=100;  blocks (or HSPs) outside min..max
489                          are discarded
490                          (default is no query coverage filtering)
491  --notrivial             do not output trivial self-alignment block if the target and query 
492                          sequences are identical. Using --self enables this option automatically
493  --output=&lt;output_file&gt;  write the alignments to the specified file name instead of stdout
494  --code=&lt;file&gt;           give quantum code for query sequence (only for display)
495  --format=&lt;type&gt;         specify output format; one of lav, axt, maf, maf+, maf-, text,
496                          lav+text, cigar, text, rdplot, general, or general:&lt;fields&gt;
497                          (by default output is LAV)
498  --rdotplot=&lt;file&gt;       create an additional output file suitable for plotting the alignments 
499                          with the R statistical package.
500  --markend               Just before normal completion, write "# lastz end-of-file" to output file
501  --census[=&lt;output_file&gt;]    count and report how many times each target base aligns, up 
502                          to 255. Ns are included in the count
503  --census16[=&lt;output_file&gt;]  count and report how many times each target base aligns, up
504                          up 65 thousand
505  --census32[=&lt;output_file&gt;]  count and report how many times each target bas aligns, up
506                          to 4 billion
507  --writecapsule=&lt;capsule_file&gt;    just write out a target capsule file and quit; don't 
508                          search for seeds or perform subsequent stages
509  --verbosity=&lt;level&gt;     set info level (0 is minimum, 10 is everything)
510                          (default is 0)
511  --[no]runtime           report runtime in the output file
512                          (default is to not report runtime)
513  --tableonly[=count]     just produce the target position table, don't
514                          search for seeds
515  --[no]stats[=&lt;file&gt;]    show search statistics (or don't)
516                          (not available in this build)
517  --version               report the program version and quit
518  --help                  list all options
519  --help=files            list information about file specifiers
520  --help=short[cuts]      list blastz-compatible shortcuts
521  --help=yasra            list yasra-specific shortcuts
522
523    </help>
524</tool>