/tools/metag_tools/shrimp_wrapper.xml
XML | 279 lines | 184 code | 38 blank | 57 comment | 0 complexity | 32a5b3c6112411b2534b8d8e8178df9d MD5 | raw file
1<tool id="shrimp_wrapper" name="SHRiMP for Letter-space" version="1.0.0"> 2 <description>reads mapping against reference sequence </description> 3 <command interpreter="python"> 4 #if ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="skip") #shrimp_wrapper.py $input_target $output1 $output2 $input_query 5 #elif ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="skip") #shrimp_wrapper.py $input_target $output1 $output2 $type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size 6 #elif ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="full") #shrimp_wrapper.py $input_target $output1 $output2 $input_query $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold 7 #elif ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="full") #shrimp_wrapper.py $input_target $output1 $output2 $type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold 8 #end if# 9 </command> 10 <inputs> 11 <page> 12 <conditional name="type_of_reads"> 13 <param name="single_or_paired" type="select" label="Single- or Paired-ends"> 14 <option value="single">Single-end</option> 15 <option value="paired">Paired-end</option> 16 </param> 17 <when value="single"> 18 <param name="input_query" type="data" format="fastqsolexa" label="Align sequencing reads" help="No dataset? Read tip below"/> 19 </when> 20 <when value="paired"> 21 <param name="insertion_size" type="integer" size="5" value="600" label="Insertion length between two ends" help="bp" /> 22 <param name="input1" type="data" format="fastqsolexa" label="Align sequencing reads, one end" /> 23 <param name="input2" type="data" format="fastqsolexa" label="and the other end" /> 24 </when> 25 </conditional> 26 <param name="input_target" type="data" format="fasta" label="against reference" /> 27 <conditional name="param"> 28 <param name="skip_or_full" type="select" label="SHRiMP settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full List"> 29 <option value="skip">Commonly used</option> 30 <option value="full">Full Parameter List</option> 31 </param> 32 <when value="skip" /> 33 <when value="full"> 34 <param name="spaced_seed" type="text" size="30" value="111111011111" label="Spaced Seed" /> 35 <param name="seed_matches_per_window" type="integer" size="5" value="2" label="Seed Matches per Window" /> 36 <param name="seed_hit_taboo_length" type="integer" size="5" value="4" label="Seed Hit Taboo Length" /> 37 <param name="seed_generation_taboo_length" type="integer" size="5" value="0" label="Seed Generation Taboo Length" /> 38 <param name="seed_window_length" type="float" size="10" value="115.0" label="Seed Window Length" help="in percentage"/> 39 <param name="max_hits_per_read" type="integer" size="10" value="100" label="Maximum Hits per Read" /> 40 <param name="max_read_length" type="integer" size="10" value="1000" label="Maximum Read Length" /> 41 <param name="kmer" type="integer" size="10" value="-1" label="Kmer Std. Deviation Limit" help="-1 as None"/> 42 <param name="sw_match_value" type="integer" size="10" value="100" label="S-W Match Value" /> 43 <param name="sw_mismatch_value" type="integer" size="10" value="-150" label="S-W Mismatch Value" /> 44 <param name="sw_gap_open_ref" type="integer" size="10" value="-400" label="S-W Gap Open Penalty (Reference)" /> 45 <param name="sw_gap_open_query" type="integer" size="10" value="-400" label="S-W Gap Open Penalty (Query)" /> 46 <param name="sw_gap_ext_ref" type="integer" size="10" value="-70" label="S-W Gap Extend Penalty (Reference)" /> 47 <param name="sw_gap_ext_query" type="integer" size="10" value="-70" label="S-W Gap Extend Penalty (Query)" /> 48 <param name="sw_hit_threshold" type="float" size="10" value="68.0" label="S-W Hit Threshold" help="in percentage"/> 49 </when> 50 </conditional> 51 </page> 52 </inputs> 53 <outputs> 54 <data name="output1" format="tabular"/> 55 <data name="output2" format="tabular"/> 56 </outputs> 57 <requirements> 58 <requirement type="binary">rmapper-ls</requirement> 59 </requirements> 60 <tests> 61 <test> 62 <param name="single_or_paired" value="single" /> 63 <param name="skip_or_full" value="skip" /> 64 <param name="input_target" value="shrimp_phix_anc.fa" ftype="fasta" /> 65 <param name="input_query" value="shrimp_wrapper_test1.fastq" ftype="fastqsolexa"/> 66 <output name="output1" file="shrimp_wrapper_test1.out1" /> 67 </test> 68 <!-- 69 <test> 70 <param name="single_or_paired" value="paired" /> 71 <param name="skip_or_full" value="skip" /> 72 <param name="input_target" value="shrimp_eca_chrMT.fa" ftype="fasta" /> 73 <param name="input1" value="shrimp_wrapper_test2_end1.fastq" ftype="fastqsolexa" /> 74 <param name="input2" value="shrimp_wrapper_test2_end2.fastq" ftype="fastqsolexa" /> 75 <param name="insertion_size" value="600" /> 76 <output name="output1" file="shrimp_wrapper_test2.out1" /> 77 </test> 78 <test> 79 <param name="single_or_paired" value="single" /> 80 <param name="skip_or_full" value="full" /> 81 <param name="input_target" value="shrimp_phix_anc.fa" ftype="fasta" /> 82 <param name="input_query" value="shrimp_wrapper_test1.fastq" ftype="fastqsolexa"/> 83 <param name="spaced_seed" value="111111011111" /> 84 <param name="seed_matches_per_window" value="2" /> 85 <param name="seed_hit_taboo_length" value="4" /> 86 <param name="seed_generation_taboo_length" value="0" /> 87 <param name="seed_window_length" value="115.0" /> 88 <param name="max_hits_per_read" value="100" /> 89 <param name="max_read_length" value="1000" /> 90 <param name="kmer" value="-1" /> 91 <param name="sw_match_value" value="100" /> 92 <param name="sw_mismatch_value" value="-150" /> 93 <param name="sw_gap_open_ref" value="-400" /> 94 <param name="sw_gap_open_query" value="-400" /> 95 <param name="sw_gap_ext_ref" value="-70" /> 96 <param name="sw_gap_ext_query" value="-70" /> 97 <param name="sw_hit_threshold" value="68.0" /> 98 <output name="output1" file="shrimp_wrapper_test1.out1" /> 99 </test> 100 <test> 101 <param name="single_or_paired" value="paired" /> 102 <param name="skip_or_full" value="full" /> 103 <param name="input_target" value="shrimp_eca_chrMT.fa" ftype="fasta" /> 104 <param name="spaced_seed" value="111111011111" /> 105 <param name="seed_matches_per_window" value="2" /> 106 <param name="seed_hit_taboo_length" value="4" /> 107 <param name="seed_generation_taboo_length" value="0" /> 108 <param name="seed_window_length" value="115.0" /> 109 <param name="max_hits_per_read" value="100" /> 110 <param name="max_read_length" value="1000" /> 111 <param name="kmer" value="-1" /> 112 <param name="sw_match_value" value="100" /> 113 <param name="sw_mismatch_value" value="-150" /> 114 <param name="sw_gap_open_ref" value="-400" /> 115 <param name="sw_gap_open_query" value="-400" /> 116 <param name="sw_gap_ext_ref" value="-70" /> 117 <param name="sw_gap_ext_query" value="-70" /> 118 <param name="sw_hit_threshold" value="68.0" /> 119 <param name="input1" value="shrimp_wrapper_test2_end1.fastq" ftype="fastqsolexa"/> 120 <param name="input2" value="shrimp_wrapper_test2_end2.fastq" ftype="fastqsolexa"/> 121 <param name="insertion_size" value="600" /> 122 <output name="output1" file="shrimp_wrapper_test2.out1" /> 123 </test> 124 --> 125 </tests> 126<help> 127 128.. class:: warningmark 129 130IMPORTANT: This tool currently only supports data where the quality scores are integers or ASCII quality scores with base 64. Click pencil icon next to your dataset to set datatype to *fastqsolexa*. 131 132 133----- 134 135**What it does** 136 137SHRiMP (SHort Read Mapping Package) is a software package for aligning genomic reads against a target genome. 138 139This wrapper post-processes the default SHRiMP/rmapper-ls output and generates a table with all information from reads and reference for the mapping. The tool takes single- or paired-end reads. For single-end reads, only uniquely mapped alignment is considered. In paired-end reads, only pairs that meet the following criteria will be used to generate the table: 1). the ends fall within the insertion size; 2). the ends are mapped at the opposite directions. If there are still multiple mappings after applying the criteria, this paired-end read will be discarded. 140 141 142----- 143 144**Input formats** 145 146A multiple-fastq file, for example:: 147 148 @seq1 149 TACCCGATTTTTTGCTTTCCACTTTATCCTACCCTT 150 +seq1 151 hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh 152 153 154----- 155 156**Outputs** 157 158The tool gives two outputs. 159 160**Table output** 161 162Table output contains 8 columns:: 163 164 1 2 3 4 5 6 7 8 165 ---------------------------------------------------- 166 chrM 14711 seq1 0 T A 40 1 167 chrM 14712 seq1 1 T T 40 1 168 169where:: 170 171 1. (chrM) - Reference sequence id 172 2. (14711) - Position of the mapping in the reference 173 3. (seq1) - Read id 174 4. (0) - Position of the mapping in the read 175 5. (T) - Nucleotide in the reference 176 6. (A) - Nucleotide in the read 177 7. (40) - Quality score for the nucleotide in the position of the read 178 8. (1) - The number of times this position is covered by reads 179 180 181**SHRiMP output** 182 183This is the default output from SHRiMP/rmapper-ls:: 184 185 1 2 3 4 5 6 7 8 9 10 186 ------------------------------------------------------------------- 187 seq1 chrM + 3644 3679 1 36 36 3600 36 188 189where:: 190 191 1. (seq1) - Read id 192 2. (chrM) - Reference sequence id 193 3. (+) - Strand of the read 194 4. (3466) - Start position of the alignment in the reference 195 5. (3679) - End position of the alignment in the reference 196 6. (1) - Start position of the alignment in the read 197 7. (36) - End position of the alignment in the read 198 8. (36) - Length of the read 199 9. (3600) - Score 200 10. (36) - Edit string 201 202 203----- 204 205**SHRiMP parameter list** 206 207The commonly used parameters with default value setting:: 208 209 -s Spaced Seed (default: 111111011111) 210 The spaced seed is a single contiguous string of 0's and 1's. 211 0's represent wildcards, or positions which will always be 212 considered as matching, whereas 1's dictate positions that 213 must match. A string of all 1's will result in a simple kmer scan. 214 -n Seed Matches per Window (default: 2) 215 The number of seed matches per window dictates how many seeds 216 must match within some window length of the genome before that 217 region is considered for Smith-Waterman alignment. A lower 218 value will increase sensitivity while drastically increasing 219 running time. Higher values will have the opposite effect. 220 -t Seed Hit Taboo Length (default: 4) 221 The seed taboo length specifies how many target genome bases 222 or colors must exist prior to a previous seed match in order 223 to count another seed match as a hit. 224 -9 Seed Generation Taboo Length (default: 0) 225 226 -w Seed Window Length (default: 115.00%) 227 This parameter specifies the genomic span in bases (or colours) 228 in which *seed_matches_per_window* must exist before the read 229 is given consideration by the Simth-Waterman alignment machinery. 230 -o Maximum Hits per Read (default: 100) 231 This parameter specifies how many hits to remember for each read. 232 If more hits are encountered, ones with lower scores are dropped 233 to make room. 234 -r Maximum Read Length (default: 1000) 235 This parameter specifies the maximum length of reads that will 236 be encountered in the dataset. If larger reads than the default 237 are used, an appropriate value must be passed to *rmapper*. 238 -d Kmer Std. Deviation Limit (default: -1 [None]) 239 This option permits pruning read kmers, which occur with 240 frequencies greater than *kmer_std_dev_limit* standard 241 deviations above the average. This can shorten running 242 time at the cost of some sensitivity. 243 *Note*: A negative value disables this option. 244 -m S-W Match Value (default: 100) 245 The value applied to matches during the Smith-Waterman score calculation. 246 -i S-W Mismatch Value (default: -150) 247 The value applied to mismatches during the Smith-Waterman 248 score calculation. 249 -g S-W Gap Open Penalty (Reference) (default: -400) 250 The value applied to gap opens along the reference sequence 251 during the Smith-Waterman score calculation. 252 *Note*: Note that for backward compatibility, if -g is set 253 and -q is not set, the gap open penalty for the query will 254 be set to the same value as specified for the reference. 255 -q S-W Gap Open Penalty (Query) (default: -400) 256 The value applied to gap opens along the query sequence during 257 the Smith-Waterman score calculation. 258 -e S-W Gap Extend Penalty (Reference) (default: -70) 259 The value applied to gap extends during the Smith-Waterman score calculation. 260 *Note*: Note that for backward compatibility, if -e is set 261 and -f is not set, the gap exten penalty for the query will 262 be set to the same value as specified for the reference. 263 -f S-W Gap Extend Penalty (Query) (default: -70) 264 The value applied to gap extends during the Smith-Waterman score calculation. 265 -h S-W Hit Threshold (default: 68.00%) 266 In letter-space, this parameter determines the threshold 267 score for both vectored and full Smith-Waterman alignments. 268 Any values less than this quantity will be thrown away. 269 *Note* This option differs slightly in meaning between letter-space and color-space. 270 271 272----- 273 274**Reference** 275 276 **SHRiMP**: Stephen M. Rumble, Michael Brudno, Phil Lacroute, Vladimir Yanovsky, Marc Fiume, Adrian Dalca. shrimp at cs dot toronto dot edu. 277 278</help> 279</tool>