PageRenderTime 9ms CodeModel.GetById 2ms app.highlight 2ms RepoModel.GetById 2ms app.codeStats 0ms

/tools/metag_tools/blat_coverage_report.xml

https://bitbucket.org/cistrome/cistrome-harvard/
XML | 75 lines | 50 code | 25 blank | 0 comment | 0 complexity | 1b30da1c17a6510523929dabd8007c65 MD5 | raw file
 1<tool id="generate_coverage_report" name="Polymorphism of the Reads">
 2	<description>the percentage of reads supporting each nucleotide at each location</description>
 3	<command interpreter="python">blat_coverage_report.py $input1 $output1</command>
 4	<inputs>	
 5		<param name="input1" type="data" format="tabular" label="Alignment result"/>
 6	</inputs>
 7	<outputs>
 8		<data name="output1" format="tabular"/>
 9	</outputs> 
10	<tests>
11		<test>
12		<param name="input1" value="blat_coverage_report_test1.txt" ftype="tabular" />
13		<output name="output1" file="blat_coverage_report_test1.out" />
14		</test>
15	</tests>
16	<help>
17
18.. class:: warningmark
19
20**IMPORTANT**. Only works for BLAT **standard** or **pslx** output formats (hint: to output pslx format, add **-out=pslx** in the command).
21
22-----
23	
24**What it does**
25 
26 The tool will generate a table of 6 columns as following:
27 
28- 1st column: chromosome id.
29
30- 2nd column: chromosome location.
31
32- 3rd column: the nucleotide from reference genome at the chromosome location (2nd column).
33
34- 4th column: total coverage of the reads (number of reads that were mapped to the chromosome location).
35
36- 5th column: percentage of reads that support nucleotide **A** at this location.
37
38- 6th column: percentage of reads that support nucleotide **T** at this location.
39
40- 7th column: percentage of reads that support nucleotide **C** at this location.
41
42- 8th column: percentage of reads that support nucleotide **G** at this location.
43 
44 
45-----
46
47**Example**
48
49- The BLAT pslx results look like the following (tab separated with sequence at the end)::
50
51	30	0	0	0	0	0	0	0	+	seq0	30	0	30	chr	4639675	4549207	4549237	1	30,	0,	4549207,	cggacagcgccgccaccaacaaagccacca,	cggacagcgccgccaccaacaaagccacca,
52	30	0	0	0	0	0	0	0	+	seq1	30	0	30	chr	4639675	614777	614807	1	30,	0,	614777,		aaaacaccggatgctccggcgctggcagat,	aaaacaccggatgctccggcgctggcagat,
53	28	1	0	0	0	0	0	0	+	seq2	30	0	29	chr	4639675	3289283	3289312	1	29,	0,	3289283,	tttgcttttagtacaccggattcagaacc,	tttgctttcagtacaccggattcagaacc,
54	30	0	0	0	0	0	0	0	+	seq4	30	0	30	chr	4639675	2665584	2665614	1	30,	0,	2665584,	cacgctacgtgcgcccccgcccagaaggcg,	cacgctacgtgcgcccccgcccagaaggcg,
55
56	The 14th column is the chromosome id, and the 16th and 17th columns shows the reads were mapped to chromosome start and end locations.	
57
58- The report showed overall coverage of reads on each chromosome location (partial result)::
59 
60   +-------+----------+------+------+--------+------+--------+------+
61   | title | location | ref. | cov. |   A    |  T   |   C    |  G   |
62   +-------+----------+------+------+--------+------+--------+------+	
63   |   chr |   614777 |	 A   |  1   | A(100) | T(0) |	C(0) | G(0) |
64   |   chr |   614778 |  A   |	1   | A(100) | T(0) |   C(0) | G(0) |
65   |   chr |   614779 |  A   |  1   | A(100) | T(0) |   C(0) | G(0) |
66   +-------+----------+------+------+--------+------+--------+------+	
67	
68-----
69
70**Reference**
71 
72 **BLAT**: Kent, W James, BLAT--the BLAST-like alignment tool. (2002) Genome Research:12(4) 656-664.
73	
74	</help>
75</tool>