PageRenderTime 28ms CodeModel.GetById 24ms app.highlight 1ms RepoModel.GetById 1ms app.codeStats 0ms

/tools/metag_tools/megablast_xml_parser.xml

https://bitbucket.org/cistrome/cistrome-harvard/
XML | 60 lines | 47 code | 13 blank | 0 comment | 0 complexity | 9832879b90a0ac447a1bfc424f1619a9 MD5 | raw file
 1<tool id="megablast_xml_parser" name="Parse blast XML output">
 2<description></description>
 3<command interpreter="python">megablast_xml_parser.py $input1 $output1</command>
 4<inputs>
 5  <param name="input1" type="data" format="blastxml" label="Megablast XML output" />
 6</inputs>
 7<outputs>
 8  <data name="output1" format="tabular"/>
 9</outputs>
10<tests>
11  <test>
12    <param name="input1" value="megablast_xml_parser_test1.gz" ftype="blastxml" />
13    <output name="output1" file="megablast_xml_parser_test1_out.tabular" ftype="tabular" />
14  </test>
15</tests>
16<help>
17
18**What it does**
19
20This tool processes the XML output of any NCBI blast tool (if you run your own blast jobs, the XML output can be generated with **-m 7** option).
21
22-----
23
24**Output fields**
25
26This tools returns tab-delimited output with the following fields::
27
28    Description                               Example
29    ----------------------------------------- ----------------- 
30
31    1. Name of the query sequence             Seq1
32    2. Length of the query sequence           30
33    3. Name of target sequence                gnl|BL_ORD_ID|0
34    4. Length of target sequence              5528445
35    5. Alignment bit score                    59.96
36    6. E-value                                8.38112e-11
37    7. Start of alignment within query        1
38    8. End of alignment within query          30
39    9. Start of alignment within target       5436010
40   10. End of alignment within target         5436039
41   11. Query frame                            1
42   12. Target frame                           1
43   13. Number of identical bases within       29 
44       the alignment
45   14. Alignment length                       30 
46   15. Aligned portion (sequence) of query    CGGACAGCGCCGCCACCAACAAAGCCACCA
47   16. Aligned portion (sequence) of target   CGGACAGCGCCGCCACCAACAAAGCCATCA
48   17. Midline indicating positions of        ||||||||||||||||||||||||||| || 
49       matches within the alignment
50
51------
52       
53.. class:: infomark
54
55Note that this form of output does not contain alignment identify value. However, it can be computed by dividing the number of identical bases within the alignment (Field 13) by the alignment length (Field 14) using *Text Manipulation->Compute* tool 
56
57
58
59</help>
60</tool>