/Scripts/xbbtools/xbb_search.py
http://github.com/biopython/biopython · Python · 196 lines · 135 code · 32 blank · 29 comment · 21 complexity · a107a3d22b77294c8101269eee6d879a MD5 · raw file
- #!/usr/bin/env python
- # Copyright 2000 by Thomas Sicheritz-Ponten.
- # Copyrigth 2016 by Markus Piotrowski.
- # All rights reserved.
- # This code is part of the Biopython distribution and governed by its
- # license. Please see the LICENSE file that should have been included
- # as part of this package.
- # Created: Sun Dec 3 13:38:52 2000
- # thomas@cbs.dtu.dk, http://www.cbs.dtu.dk/thomas
- """Search code for graphical Xbbtools tool."""
- import re
- import tkinter as tk
- import tkinter.ttk as ttk
- from tkinter import colorchooser
- from Bio.Data.IUPACData import ambiguous_dna_values
- from Bio.Seq import reverse_complement
- import xbb_widget
- class DNAsearch:
- """Class to search a DNA sequence."""
- def __init__(self):
- """Set up the alphabet."""
- self.init_alphabet()
- self.sequence = ""
- def init_alphabet(self):
- """Expand alphabet values for ambiguous codes."""
- self.alphabet = ambiguous_dna_values
- other = "".join(self.alphabet)
- self.alphabet["N"] = self.alphabet["N"] + other
- for key in self.alphabet:
- if key == "N":
- continue
- if key in self.alphabet[key]:
- continue
- self.alphabet[key] = self.alphabet[key] + key
- def SetSeq(self, seq):
- """Set sequence."""
- self.sequence = seq
- def SetPattern(self, pattern):
- """Convert search pattern to regular expression."""
- self.pattern = pattern
- self.rx_pattern = self.IUPAC2regex(pattern)
- self.rx = re.compile(self.rx_pattern)
- def IUPAC2regex(self, s):
- """Translate search text into pattern."""
- rx = ""
- for i in s:
- r = self.alphabet.get(i, i)
- if len(r) > 1:
- rx = f"{rx}[{r}]"
- else:
- rx += r
- return rx
- def _Search(self, start=0):
- """Search and return MatchObject (PRIVAT)."""
- # Only called from SearchAll. Is it used?
- pos = self.rx.search(self.sequence, start)
- return pos
- def Search(self, start=0):
- """Search for query sequence and return position."""
- pos = self.rx.search(self.sequence, start)
- if pos:
- return pos.start()
- else:
- return -1
- def SearchAll(self):
- """Search the whole sequence."""
- # Doesn't seem to be used...
- pos = -1
- positions = []
- while True:
- m = self._Search(pos + 1)
- if not m:
- break
- pos = m.start()
- if pos == -1:
- break
- positions.append(pos)
- return positions
- class XDNAsearch(tk.Toplevel, DNAsearch):
- """Graphical tools to perform the DNA search."""
- def __init__(self, seq="", master=None, highlight=0):
- """Initialize the search GUI."""
- DNAsearch.__init__(self)
- self.master = master
- self.highlight = highlight
- self.colors = []
- self.init_graphics()
- self.sequence = seq
- self.cur_pos = 0
- def init_graphics(self):
- """Build the search window."""
- tk.Toplevel.__init__(self, self.master)
- self.frame = ttk.Frame(self)
- self.frame.pack(fill=tk.BOTH, expand=1)
- self.search_entry = ttk.Entry(self.frame)
- self.search_entry.pack(fill=tk.BOTH, expand=1)
- f2 = ttk.Frame(self.frame)
- f2.pack(side=tk.TOP, fill=tk.BOTH, expand=1)
- f = f2
- self.forward = ttk.Button(f, text="Search +", command=self.do_search)
- self.forward.pack(side=tk.LEFT)
- self.forward = ttk.Button(
- f, text="Search -", command=lambda x=self.do_search: x(other_strand=1)
- )
- self.forward.pack(side=tk.LEFT)
- self.cancel = ttk.Button(f, text="Cancel", command=self.exit)
- self.cancel.pack(side=tk.LEFT)
- self.current_color = "cyan"
- self.colorb = ttk.Button(f, text="Color", command=self.change_color)
- self.colorb.pack(side=tk.LEFT)
- self.config_color(self.current_color)
- def config_color(self, color=None):
- """Set color for found sequence tag."""
- if not self.highlight:
- return
- if not color:
- color = colorchooser.askcolor()[1]
- if not color:
- color = "cyan"
- self.current_color = color
- self.current_tag = f"searched_{self.current_color}"
- self.master.tag_config(self.current_tag, background=self.current_color)
- self.master.tag_config(
- self.current_tag + "R", background=self.current_color, underline=1
- )
- self.colors.append(color)
- def change_color(self):
- """Call back for color button."""
- self.config_color()
- def get_pattern(self):
- """Retrieve query sequence."""
- pattern = self.search_entry.get()
- return pattern
- def do_search(self, other_strand=0):
- """Start the search."""
- pattern = self.get_pattern()
- if other_strand:
- pattern = reverse_complement(pattern)
- self.SetPattern(pattern)
- pos = self.Search(self.cur_pos)
- self.cur_pos = pos + 1
- w = self.master
- if pos != -1:
- if self.highlight:
- start, stop = pos, pos + len(self.pattern)
- if other_strand:
- w.tag_add(self.current_tag + "R", f"1.{start:d}", f"1.{stop}")
- else:
- w.tag_add(self.current_tag, f"1.{start:d}", f"1.{stop}")
- w.see(f"1.{start:d}")
- def exit(self):
- """Clean up on exit."""
- for c in self.colors:
- self.master.tag_remove(f"searched_{c}", 1.0, tk.END)
- self.master.tag_remove(f"searched_{c}R", 1.0, tk.END)
- self.destroy()
- del self
- if __name__ == "__main__":
- win = tk.Tk()
- xbbtools = xbb_widget.xbb_widget()
- seq = "ATGGTGTGTGTGTACGATCGCCCCCCCCAGTCGATCGATGCATCGTA"
- xbbtools.insert_sequence(("Test_seq", seq))
- xbbtools.search()
- win.mainloop()