/tools/fasta_tools/fasta_compute_length.xml
https://bitbucket.org/ialbert/galaxy-genetrack · XML · 51 lines · 39 code · 12 blank · 0 comment · 0 complexity · 37810fd3b2412a1e7a1f69aef68faef3 MD5 · raw file
- <tool id="fasta_compute_length" name="Compute sequence length">
- <description></description>
- <command interpreter="python">fasta_compute_length.py $input $output $keep_first</command>
- <inputs>
- <param name="input" type="data" format="fasta" label="Compute length for these sequences"/>
- <param name="keep_first" type="integer" size="5" value="0" label="How many title characters to keep?" help="'0' = keep the whole thing"/>
- </inputs>
- <outputs>
- <data name="output" format="tabular"/>
- </outputs>
- <tests>
- <test>
- <param name="input" value="454.fasta" />
- <param name="keep_first" value="0"/>
- <output name="output" file="fasta_tool_compute_length_1.out" />
- </test>
-
- <test>
- <param name="input" value="extract_genomic_dna_out1.fasta" />
- <param name="keep_first" value="0"/>
- <output name="output" file="fasta_tool_compute_length_2.out" />
- </test>
-
- <test>
- <param name="input" value="454.fasta" />
- <param name="keep_first" value="14"/>
- <output name="output" file="fasta_tool_compute_length_3.out" />
- </test>
- </tests>
- <help>
- **What it does**
- This tool counts the length of each fasta sequence in the file. The output file has two columns per line (separated by tab): fasta titles and lengths of the sequences. The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry.
- -----
- **Example**
- Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run::
- >EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_
TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG
TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
>EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_
AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAAfa
- Running this tool while setting **How many characters to keep?** to **14** will produce this::
-
- EYKX4VC02EQLO5 108
- EYKX4VC02D4GS2 60
- </help>
- </tool>