/tools/fastq/fastq_paired_end_splitter.xml
https://bitbucket.org/h_morita_dbcls/galaxy-central · XML · 56 lines · 42 code · 14 blank · 0 comment · 0 complexity · c2863d819b63acd2a8c3beac162bcf97 MD5 · raw file
- <tool id="fastq_paired_end_splitter" name="FASTQ splitter" version="1.0.0">
- <description>on joined paired end reads</description>
- <command interpreter="python">fastq_paired_end_splitter.py '$input1_file' '${input1_file.extension[len( 'fastq' ):]}' '$output1_file' '$output2_file'</command>
- <inputs>
- <param name="input1_file" type="data" format="fastqsanger,fastqcssanger" label="FASTQ reads" />
- </inputs>
- <outputs>
- <data name="output1_file" format="input" />
- <data name="output2_file" format="input" />
- </outputs>
- <tests>
- <test>
- <param name="input1_file" value="3.fastqsanger" ftype="fastqsanger" />
- <output name="output1_file" file="split_pair_reads_1.fastqsanger" />
- <output name="output2_file" file="split_pair_reads_2.fastqsanger" />
- </test>
- </tests>
- <help>
- **What it does**
- Splits a single fastq dataset representing paired-end run into two datasets (one for each end). This tool works only for datasets where both ends have **the same** length.
- Sequence identifiers will have /1 or /2 appended for the split left-hand and right-hand reads, respectively.
- -----
- **Input format**
- A multiple-fastq file, for example::
- @HWI-EAS91_1_30788AAXX:7:21:1542:1758
- GTCAATTGTACTGGTCAATACTAAAAGAATAGGATCGCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA
- +HWI-EAS91_1_30788AAXX:7:21:1542:1758
- hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR
- -----
- **Outputs**
- Left-hand Read::
- @HWI-EAS91_1_30788AAXX:7:21:1542:1758/1
- GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC
- +HWI-EAS91_1_30788AAXX:7:21:1542:1758/1
- hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
- Right-hand Read::
- @HWI-EAS91_1_30788AAXX:7:21:1542:1758/2
- GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA
- +HWI-EAS91_1_30788AAXX:7:21:1542:1758/2
- hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR
- </help>
- </tool>