PageRenderTime 18ms CodeModel.GetById 16ms app.highlight 1ms RepoModel.GetById 0ms app.codeStats 0ms

/tools/fasta_tools/fasta_to_tabular.xml

https://bitbucket.org/h_morita_dbcls/galaxy-central
XML | 51 lines | 39 code | 12 blank | 0 comment | 0 complexity | a2eeacb89ed3fc35184b098ef5eb8047 MD5 | raw file
 1<tool id="fasta2tab" name="FASTA-to-Tabular" version="1.0.0">
 2	<description>converts FASTA file to tabular format</description>
 3	<command interpreter="python">fasta_to_tabular.py $input $output $keep_first</command>
 4	<inputs>
 5		<param name="input" type="data" format="fasta" label="Convert these sequences"/>
 6		<param name="keep_first" type="integer" size="5" value="0" label="How many title characters to keep?" help="'0' = keep the whole thing"/>
 7	</inputs>
 8	<outputs>
 9		<data name="output" format="tabular"/>
10	</outputs>
11	<tests>
12		<test>
13			<param name="input" value="454.fasta" />
14			<param name="keep_first" value="0"/>
15			<output name="output" file="fasta_to_tabular_out1.tabular" />
16		</test>
17		
18		<test>
19			<param name="input" value="4.fasta" />
20			<param name="keep_first" value="0"/>
21			<output name="output" file="fasta_to_tabular_out2.tabular" />
22		</test>
23		
24		<test>
25			<param name="input" value="454.fasta" />
26			<param name="keep_first" value="14"/>
27			<output name="output" file="fasta_to_tabular_out3.tabular" />
28		</test>
29	</tests>
30	<help>
31	
32**What it does**
33
34This tool converts FASTA formatted sequences to TAB-delimited format. The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. 
35
36-----	
37
38**Example**
39
40Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run::
41
42    &gt;EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_
43    TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG
44    TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
45    &gt;EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_
46    AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAA
47
48Running this tool while setting **How many characters to keep?** to **14** will produce this::
49	
50	EYKX4VC02EQLO5  TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACGTTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
51	EYKX4VC02D4GS2  AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAA
52
53
54	</help>
55</tool>