PageRenderTime 20ms CodeModel.GetById 18ms app.highlight 1ms RepoModel.GetById 0ms app.codeStats 0ms

/test-data/fastx_trimmer1.fasta

https://bitbucket.org/h_morita_dbcls/galaxy-central
Unknown | 4 lines | 4 code | 0 blank | 0 comment | 0 complexity | f262acae67fd54f675f8ed55a28f3a59 MD5 | raw file
1>CSHL__2_FC042NGABCD:8:1:120:202
2ACGATAGATCGGAAGAGCTAGTATGCCGTTTTCTGC
3>CSHL__2_FC042NGABCD:8:1:103:1185
4ATCACGATAGATCGGCAGAGCTCGTTTACCGTCTTC