PageRenderTime 28ms CodeModel.GetById 20ms app.highlight 2ms RepoModel.GetById 3ms app.codeStats 0ms

/test-data/fastqsolexa_to_fasta_qual_out2.fasta

https://bitbucket.org/h_morita_dbcls/galaxy-central
Unknown | 4 lines | 4 code | 0 blank | 0 comment | 0 complexity | 3f18b854ed9d4fd67483b741a7b510dc MD5 | raw file
1>seq1
2GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT
3>seq2
4GCAATGACGGCAGCAATAAACTCAACAGGTGCTGG