PageRenderTime 13ms CodeModel.GetById 11ms app.highlight 1ms RepoModel.GetById 0ms app.codeStats 0ms

/test-data/fastq_conv_out4.fasta

https://bitbucket.org/h_morita_dbcls/galaxy-central
Unknown | 4 lines | 4 code | 0 blank | 0 comment | 0 complexity | df75badb986d3609a7a8bec7678c523e MD5 | raw file
1>1831_573_1004/1
2AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG
3>1831_573_1050/1
4TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT